Aug 15, 2020
Version 4
SalivaDirect: RNA extraction-free SARS-CoV-2 diagnostics V.4
- Chantal Vogels1,
- Doug E. Brackney2,1,
- Chaney C Kalinich1,
- Isabel M Ott1,
- Nathan D Grubaugh1,
- Anne Wyllie1
- 1Department of Epidemiology of Microbial Diseases, Yale School of Public Health;
- 2Department of Environmental Sciences The Connecticut Agricultural Experiment Station
- Coronavirus Method Development Community
- XPRIZE Rapid Covid Testing
External link: https://covidtrackerct.com/about-salivadirect/
Protocol Citation: Chantal Vogels, Doug E. Brackney, Chaney C Kalinich, Isabel M Ott, Nathan D Grubaugh, Anne Wyllie 2020. SalivaDirect: RNA extraction-free SARS-CoV-2 diagnostics. protocols.io https://dx.doi.org/10.17504/protocols.io.bjswknfe
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 15, 2020
Last Modified: February 10, 2023
Protocol Integer ID: 40502
Keywords: SARS-CoV-2, COVID-19, saliva, extraction-free PCR, COVID-19 diagnostics
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
SalivaDirect is an RNA-extraction free, dual-plexed RT-qPCR method for SARS-CoV-2 detection. It can be broadly implemented as it (1) does not require saliva collection tubes containing preservatives, (2) does not require specialized equipment for RNA extraction, and (3) is validated for use with products from multiple vendors. Thus, the simplicity and flexibility of SalivaDirect means that it is not as affected by supply chain bottlenecks as some other assays. Our method is RNA-extraction free which enables testing of low volume and minimally processed saliva in dual-plexed RT-qPCR for SARS-CoV-2 detection. Saliva will be treated with proteinase K followed by a heat inactivation step, and is then directly used as input in the dual-plexed RT-qPCR test. Our aim was not to design new primers and probes for RT-qPCR testing, but rather to use validated primer and probe sets (N1 and RP) developed by the US CDC. The human Ribonuclease P (RP) probe was modified with a different fluorophore so that the primer/probe set could be combined in a dualplex assay, reducing the number of tests to 1 assay with 2 sets.
Version 2 includes:
- Optimized thermocycler conditions
- Locally validated alternative options for Proteinase K, RT-qPCR master mix, and thermocyclers
- Use of 8-strip tubes for sample processing step, due to contamination issues in 96-well plates.
Version 3 has been updated to remove steps for sample self-collection.
Version 4 has updated Ct thresholds for the ABI 7500 Fast Dx.
Materials
Sample collection
- Wide-mouth collection tube/container labelled with unique subject identity number and collection data.
Note
15 mL conical tubes are not recommended due to their long, narrow opening. This design increases the risk of contaminating pipettes when aliquoting the collected sample.
Urine cups can also be used for sample collection; however, they are difficult to vortex during the processing step, and thus we do not recommend them.
- Personal protective equipment (PPE) for sample collector. (at minimum, gloves and face mask)
Extraction-free sample processing
- Thermocycler or real-time PCR (qPCR) instrument
- Vortex mixer
- Plate centrifuge or spinner
- Pipette (P20 and P200)
- Pipette tips (20 µL and 200 µL)
- 8-strip PCR tubes (200 µL capacity)
- Proteinase K (volumes for different concentrations given in text)
- Saliva samples (see “sample collection”)
SARS-CoV-2 RNA Detection by Dual-Plex RT-qPCR
Bio-Rad CFX96
ABI 7500 Fast
ABI 7500 Fast Dx
- 96 well optical PCR plate and adhesive film
- Plate centrifuge or spinner
- 1.5 mL tube centrifuge
- Vortex
- Pipettes (P10, P20, P200, and P1000 - optional P10 multichannel)
- Pipette tips (10 µL, 20 µL, 200 µL, and 1000 µL)
- Adhesive film applicator
- Nuclease-free water
- 70% ethanol, for cleaning
- Twist synthetic SARS-CoV-2 RNA controls at 100 copies/uL
- Extraction-free saliva samples (see “extraction-free sample processing”)
- Primers and probes, as follows.
| Target | Primer/probe | Sequence | |
| CDC-N1 | 2019-nCoV_N1-F | GACCCCAAAATCAGCGAAAT | |
| 2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG | ||
| 2019-nCoV_N1-P | FAM-ACCCCGCATTACGTTTGGTGGACC-IBFQ | ||
| Human RNase P | RP-F | AGATTTGGACCTGCGAGCG | |
| RP-R | GAGCGGCTGTCTCCACAAGT | ||
| RP-P | Cy5-TTCTGACCTGAAGGCTCTGCGCG-IBRQ |
Stocks can be kept at 100 uM, and will be diluted to working concentrations of 20 uM at the beginning of the RT-qPCR protocol section.
Safety warnings
Processing of any sample type which could potentially be positive for SARS-CoV-2 should be conducted in BSL2+ settings. Before starting work with these samples, please contact your local EHS (environment, health and safety) or biosafety office for proper guidance on how to work with these samples in your laboratory.
Before start
The FDA issued Emergency Use Authorization for SalivaDirect on 15 August 2020. To become a designated laboratory to run SalivaDirect contact us at contact@salivadirect.org. Describe who you are, your intended use, and what equipment you have so that we can make sure that your system is matched to your protocol. We will work with you to conduct any bridging studies, if needed. You must have a CLIA-certified lab in the United States.
While collecting saliva is significantly easier than swabs, saliva samples can be difficult to work with. It is important to follow the sample collection guidelines to ensure that saliva, not sputum, is being collected.
Sample collection
Sample collection
Saliva should be collected with the assistance of a healthcare worker or technician.
Before collection, clean hands using alcohol-based sanitizer or soap and water (no fragrances) and don appropriate PPE (at minimum, gloves and a mask).
Ensure all collection materials are labelled with the correct identifying information.
While preparing collection materials, direct the sample provider to begin pooling saliva in their mouth. Saliva production can be stimulated by thinking about food (favorite foods, upcoming meals, etc.) or about the saliva collection itself.
Note
This protocol is intended for the collection of the normal saliva that naturally pools into the mouth. No coughing or sniffing prior to sample collection is required.
Ideally, water should be avoided 10 minutes prior to collection. Other drinks, food, and nasal sprays should be avoided for half an hour before sample collection.
Remove the lid of the collection container, and direct the sample provider to gently expel saliva into the container until at least 0.5 mL has been collected.
Note
The total volume measured is to exclude any bubbles.
Once at least 0.5 mL has been collected, securely replace the lid of the collection container.
Sterilize the container surface with 70% ethanol or a disinfecting wipe, and place the sample in a secondary container or an appropriately labeled biohazard bag.
Dispose of gloves, and register the sample collection (including date and time).
Transfer the sample at room temperature to the laboratory for sample processing. The virus RNA in saliva remains stable at room temperature for at least 7 days.
Store samples at 2-8°C until sample transport or processing (up to 7 days) or at -80°C for longer term storage.
Extraction-free sample processing
Extraction-free sample processing
Add Proteinase K (see table for volume per sample) to designated 8-strip PCR tubes (200 µL capacity).
| Vendor | Concentration | Volume | |
| ThermoFisher Scientific MagMAX™ Viral/Pathogen Proteinase K | 50 mg/mL | 2.5 µL | |
| New England Biolabs Proteinase K, Molecular Biology Grade | 20 mg/mL | 6.25 µL | |
| AmericanBio Proteinase K | Lyophilized (add 50 mg per 1 mL of nuclease-free water) | 2.5 µL |
Safety information
This work should be completed under BSL-2 conditions, and samples potentially containing SARS-CoV-2 should only be handled in a biosafety cabinet. Please seek guidance from your local biosafety office on specific recommendations for working with samples which could contain SARS-CoV-2.
Vortex each saliva sample until homogeneous, and immediately transfer 50 µL saliva to each 8-strip PCR tube containing proteinase K.
Close the 8-strip tube lids tightly.
Place the 8-strip tubes in a rack and vortex for 1 minute at 3000-5000 RPM.
Briefly spin down the rack/tubes using a plate spinner or 8-strip tube microcentrifuge.
Note
If no plate centrifuge or spinner is available, the plate can be gently tapped to get the samples at the bottom of each well.
Inactivate the proteinase K by heating samples for 5 minutes at 95°C on a PCR instrument or equivalent thermocycler.
Briefly spin down the tubes using a plate spinner or 8-strip tube microcentrifuge.
Store samples at -80°C or proceed immediately to RT-qPCR testing.
RT-qPCR
RT-qPCR
Prepare 20 uM working stocks of the primers and probes (sequences provided in Materials) by adding 20 µL of 100 uM stock to 80 µL nuclease-free water.
Note
Briefly vortex and centrifuge reagents before use.
Probes are photosensitive and should be stored in the dark.
Use the 20 uM working stocks to prepare dualplex primer-probe-water mix containing the following:
| Component | Volume (1 reaction) | Volume (100 reactions) | |
| 2019-nCoV_N1-F (400 nM/reaction) | 0.4 µL | 40 µL | |
| 2019-nCoV_N1-R (400 nM/reaction) | 0.4 µL | 40 µL | |
| 2019-nCoV_N1-P (200 nM/reaction) | 0.2 µL | 20 µL | |
| RP-F (150 nM/reaction) | 0.15 µL | 15 µL | |
| RP-R (150 nM/reaction) | 0.15 µL | 15 µL | |
| RP-P (200 nM/reaction) | 0.2 µL | 20 µL | |
| Nuclease-free water | 2.5 µL | 250 µL |
A larger volume of primer-probe-water mix can be prepared in advance, aliquoted in LightSafe microcentrifuge tubes, and stored at -20°C.
On ice, prepare a master mix containing the following (account for 10% extra lost during pipetting).
Note
Briefly vortex and centrifuge reagents before use.
| Component | NEB Luna | Bio-Rad Reliance | Thermo TaqPath | |
| Master mix | 10 µL | 5 µL | 5 µL | |
| RT | 1 µL | - | - | |
| Primer-probe-water mix (see above) | 4 µL | 4 µL | 4 µL | |
| Nuclease-free water | - | 6 µL | 6 µL |
5 µL Proteinase K-treated samples, standards, or controls will be added to each well individually in step 15, for a total 20 µL reaction.
Kit order info:
Validation data, including demonstrated compatibility between kits and thermocyclers, are available here.
Place the 96-well PCR plate on the PCR plate cooler, and add 15 µL of mastermix to each designated well.
Bring the processed samples and the PCR mastermix plate to a biosafety cabinet.
Safety information
Most institutions will require samples potentially containing full-length SARS-CoV-2 RNA to be handled in a biosafety cabinet. Please seek guidance from your local biosafety office on specific recommendations for working with samples which could contain full-length SARS-CoV-2 RNA.
Add 5 µL of extraction-free saliva sample to each designated well of the mastermix plate. Mix by pipetting, taking care to avoid introducing bubbles.
Note
Extraction-free saliva samples can be added using a multichannel pipette for high-throughput testing.
RT-qPCR
RT-qPCR
Add 5 µL of positive control (Twist synthetic SARS-CoV-2 RNA controls at 100 copies/uL) and no-template control (NTC - water) to designated PCR wells for the controls (1 NTC, and 2 positive controls per plate). Mix by pipetting, taking care to avoid introducing bubbles.
Seal with a transparent plastic qPCR seal. Centrifuge briefly to remove bubbles, if present.
Load the plate into the qPCR machine, and run the following thermocycler conditions:
| Step | Temperature | Time | |
| 1 | 52°C | 10 min | |
| 2 | 95°C | 2 min | |
| 3 | 95°C | 10 sec | |
| 4 | 55°C | 30 sec | |
| 5 | Read plate (FAM & Cy5 channels) | ||
| Repeat steps 3-5 for 44 cycles. | |||
Real-time PCR (qPCR) instruments currently locally validated: Bio-Rad CFX96, ABI 7500 Fast, and ABI 7500 Fast Dx. Validation data, including demonstrated compatibility between kits and thermocyclers, are available here.
Report results per the following criteria:
| Bio-Rad CFX96 & ABI 7500 Fast | ||||
| Output | Significance | RP CT | N1 CT | |
| 0 | Negative | <35 | ≥40 | |
| 1 | Invalid | ≥35 | ≥40 | |
| 2 | Positive | any value | <40 | |
| ABI 7500 Fast Dx | ||||
| Output | Significance | RP CT | N1 CT | |
| 0 | Negative | <35 | ≥40 | |
| 1 | Invalid | ≥35 | ≥40 | |
| 2 | Positive | any value | <37 | |