Apr 17, 2020

Public workspaceRTPCR Amplification of SARS-CoV2 Whole Genome for Illumina NGS

DOI
dx.doi.org/10.17504/protocols.io.bew8jfhw
  • Monica Galiano1,
  • Shahjahan Miah2,
  • Angie Lackenby2,
  • Omolola Akinbami2,
  • Joanna Ellis2,
  • Maria Zambon2
  • 1WHO Influenza Collaborating Centre, The Francis Crick Institute;
  • 2Respiratory Virus Unit, Microbiology Services Colindale, Public Health England
  • Coronavirus Method Development Community
Monica Galiano
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.bew8jfhw
Protocol Citation: Monica Galiano, Shahjahan Miah, Angie Lackenby, Omolola Akinbami, Joanna Ellis, Maria Zambon 2020. RTPCR Amplification of SARS-CoV2 Whole Genome for Illumina NGS . protocols.io https://dx.doi.org/10.17504/protocols.io.bew8jfhw
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 10, 2020
Last Modified: April 17, 2020
Protocol Integer ID: 35520
Keywords: whole genome, Illumina, SARS-COV2, WGS SARS-COV2, COVID19, nCOV, nCOV-2019,
Abstract
SUMMARY
This document describes the procedure for performing RTPCR amplification for next-generation sequencing (NGS) of whole genomes from SARS-CoV2 positive clinical samples. This methodology was employed at the Respiratory Virus Unit, Microbiology Services Colindale, Public Health England (RVU-PHE) to sequence the first SARS-CoV2 positive samples.
Reverse transcription (RT) is performed using random hexamer primers. PCR amplification is done using sequence-specific primers which amplify two sets of 30-31 overlapping amplicons (size 1.0 to 1.8 kb), each set independently covering the entire length of the MERS-CoV genome. Once amplicons are obtained, rough equimolar mixtures, clean-up, DNA quantitation and final dilutions are performed to prepare samples for library preparation for Illumina MiSeq next-generation sequencing (NGS).
Primers from set A do not overlap location of primers from set B, except for those binding at the end of the genome (see figure 1). Amplicon mixtures from each set are treated as separate samples throughout the procedure, including assembly. Merging (or comparison) of consensus sequences of both sets is performed at the end.

IMPORTANT: Please note that every amplicon is obtained in a separate PCR reaction and, if using both primer sets, there is a total of ~61 PCR reactions; this protocol is NOT a multiplex approach. We recommend using a 96-well plate per sample.

ADVANTAGES AND LIMITATIONS

The use of both primer sets allows for redundancy in whole genome (WG) coverage, which increases the chances of obtaining full genome sequences when samples have low viral load. Although we haven’t formally determined the sensitivity of this assay (or limit of amplification of WG), we have obtained full coverage with samples with CT values of up to 38 (CT value obtained at RVU-PHE with RdRp gene detection within the SARS-CoV2 detection protocol as described by Corman et al. [1]). Variation in storage or transport conditions of samples may affect the integrity of viral nucleic acids.
Another advantage of this protocol is that, as primers from set A and B match different locations on the genome, direct comparison of the sequences obtained with each set allows for curation of primer-induced contamination of the sequences, although we deal with this with a specific step on the bioinformatic assembly pipeline (not described here).
Alternatively, when samples have a relatively good CT (<30) only set A may be used, simplifying the amplification and library steps.
The main limitation of this protocol is its unsuitability for high throughput processing of large batches of samples, although current efforts are being made to adapt the primers to a multiplex approach.
Materials
EQUIPMENT
PCR thermocycler for 96-well plates
Vortex
Pipettes with disposable filter tips
Ice bucket
Microcentrifuge and picofuge
Plate centrifuge
Mother E-base
96-well plates with adhesive seals
1.5ml and 0.2ml polypropylene tubes/strip tubes
Benchtop UV transilluminator (UVP)
Qubit Fluorometer (Life Technologies)
Qubit Assay Tubes (Life Technologies)
FrameStar FastPlate 96 (4titude)
Aluminum StarSeal (PCR) E2796-9792, StarLab


REAGENTS
SuperScript™ VILO™ cDNA Synthesis Kit (ThermoFisher, Invitrogen cat 11754050)
dNTP set 100mM (ThermoFisher, Invitrogen cat 10297018)
Oligonucleotide primers 100pmol/µl stocks (Eurofins) (see Appendix 3)
Platinum Taq DNA polymerase HiFi (ThermoFisher, Invitrogen cat 11304029)
Nuclease-free water (Severn Biotech)
1% or 2% E-gels 48-wells (invitrogen)
10x TBE buffer
DNA 1Kb plus ladder (Invitrogen cat 10787018)
BlueJuice 10X Gel loading buffer (ThermoFisher, Invitrogen cat10816015)
Qubit dsDNA HS Assay Kit (ThermoFisher, Invitrogen Q32854)
QIAquick PCR purification kit (cat 28106)
Safety warnings
Sample inactivation in lysis buffer should be performed at BSL3
A total amount of 140 µl of RNA (includes some excess) are needed to set up the necessary volume of RT reactions. RNA should be kept on ice or stored at Temperature-80 °C if not immediately used.

The RT reaction is as follows (Table 1):

RT mix x 1 (µl)Bulk mix (x 14)
Water 4.0 56
5X VILO Reaction mix 4.0 56
10X Superscript Enzyme mix 2.0 28
RNA 10.0 140
Final volume 20.0 280
Table 1


To ensure uniform heat distribution, we aliquot this mix into 7 x 0.2 (strip) tubes.
Cycling program:
Temperature25 °C Duration00:10:00
Temperature42 °C Duration01:00:00
Temperature85 °C Duration00:05:00
Hold at Temperature4 °C
Keep cDNA on ice or store at Temperature-80 °C if not immediately used.


Combine primers according to Tables 1 and 2 (4.1) and dilute as follows to get a working primer dilution of 5 pmol/µl
Note
Preparation of primer mix pairs (working dilution 5 pmol/µl)
Use different colours of strip tubes, e.g. yellow strip tubes for SET A and purple strip tubes for SET B. Add 180 µl of water + 10µl of each Forward and Reverse primers at 100 pmol/µl, according to Appendix 2. Vortex to mix. Store at -20°C.

Thaw both sets of primer mixes, briefly vortex them and spin down. Using a multichannel pipette (volume 0.5 or 1 to 10 µl) load 4 µl of primer mixes to the corresponding wells of a 96-well PCR plate, according to Figure 2. Keep the PCR plate on a cooler.




The position of primers on the nCOV genome sequence has been based on the sequence of strain hCoV-19/Wuhan/IVDC-HB-01/2019 (GISAID accession EPI_ISL_402119). We gratefully acknowledge the authors (Wenjie Tan et al), originating and submitting laboratory (National Institute for Viral Disease Control and Prevention, China CDC) of this sequence from GISAID’s EpiCOV™ Database on which this protocol is based.

Primer pairForward primerSequencePosition of 5'endReverse primerSequencePosition of 5'endAmplicon size
1Ancov-1FATTAAAGGTTTATACCTTCCCAGGTAAC1ncov-1032R     TCAAAAGGTGTCTGCAATTCAT10321031
2Ancov-15F     CCTTCCCAGGTAACAAACCA15ncov-1032R     TCAAAAGGTGTCTGCAATTCAT10321017
3Ancov-693F     TTGACTTAGGCGACGAGCTT693ncov-2030R     CAGATGTGAACATCATAGCATCAA20301337
4Ancov-1684F     CGCCATTATTTTGGCATCTT1684ncov-3019R     TGAAGCCAATTTAAACTCACCA30191335
5Ancov-2665F     TGCCCTTGCACCTAATATGAT2665ncov-4010R     GGAACTTAGTTTCTTCCAGAGTTG40101345
6Ancov-3686F     CACGAAGTTCTACTTGCACCA3686ncov-5015R     CAACTTGCGTGTGGAGGTTA50151329
7Ancov-4667F     TCTCTCAAAGTGCCAGCTACAG4667ncov-6037R     GCTTGCGTTTGGATATGGTT60371370
8Ancov-5687F     TCAGCACCACCTGCTCAGTA5687ncov-7021R     AACACCTAAAGCAGCGGTTG70211334
9Ancov-6688F     TGCTAAGCCTTTTCTTAACAAAGTT6688ncov-8027R     CTGCAACTTCCGCACTATCA80271339
10Ancov-7663F     TGATGAAGTTGCGAGAGACTTG7663ncov-9019R     TTCAGCAGCCAAAACACAAG90191356
11Ancov-8700F     TTGATGGTGGTGTCACTCGT8700ncov-10033RAGAGGTTTGTGGTGGTTGGT100331333
12Ancov-9699F     TCATTTGTATTTCCACAAAGCA9699ncov-11071RCAAAGACCATTGAGTACTCTGGA110711372
13Ancov-10696FTGGAGACAGGTGGTTTCTCA10696ncov-12030RTGCATGGAAAGCAAAACAGA120301334
14Ancov-11668FCCGCTACTTTAGACTGACTCTTGG11668ncov-13050RGCAGGCACTTCTGTTGCAT130501382
15Ancov-12701FCCTGTTGCACTACGACAGATG12701ncov-14043RAATACCAGCATTTCGCATGG140431342
16Ancov-13663FCACACTTTCTCTAACTACCAACATGAA13663ncov-15028RATGCGAAAAGTGCATCTTGA150281365
17Ancov-14663FAAACTGTCAAACCCGGTAATTTT14663ncov-16023RAGACACGAACCGTTCAATCA160231360
18Ancov-15686FTGCGTAAACATTTCTCAATGATG15686ncov-17038RTTGCAACATTGCTAGAAAACTCA170381352
19Ancov-16689FTGCTACTGTACGTGAAGTGCTG16689ncov-18034RAAGTTGCCACATTCCTACGTG180341345
20Ancov-17694FTGCAATTAACAGGCCACAAA17694ncov-19031RTCGTGAAGAACTGGGAATTTG190311337
21Ancov-18683FCATGCTTTTCCACTGCTTCA18683ncov-20043RAACACCATTACGGGCATTTC200431360
22Ancov-19664FTTGATGGACAACAGGGTGAA19664ncov-21231RGTCCACCATGCGAAGTGTC212311567
23Ancov-20863FCATTTTGGTGCTGGTTCTGA20863ncov-22226RCGAAAAACCCTGAGGGAGAT222261363
24Ancov-21896FTTCGAAGACCCAGTCCCTAC21896ncov-23214RCACCTGTGCCTGTTAAACCA232141318
25Ancov-22883FTCTTGATTCTAAGGTTGGTGGT22883ncov-24231RCACCAAAGGTCCAACCAGAA242311348
26Ancov-23850FTTAAACCGTGCTTTAACTGGAATA23850ncov-25243RATGGCAATCAAGCCAGCTAT252431393
27Ancov-24858FGGCACACACTGGTTTGTAACAC24858ncov-26224RTGCTTACAAAGGCACGCTAGT262241366
28Ancov-25886FTCTTCAATTGTCATTACTTCAGGTG25886ncov-27227RCCTGAAAGTCAACGAGATGAAA272271341
29Ancov-26889FGCCACTCCATGGCACTATTC26889ncov-28191RTTCATAGAACGAACAACGCACT281911302
30Ancov-27876FTTGTCACGCCTAAACGAACA27876ncov-29226RACATTCCGAAGAACGCTGAA292261350
31Ancov-28871FAGGCAGCAGTAGGGGAACTT28871ncov-29848RAAAATCACATGGGGATAGCA29848977
Table 2. Set A: Primer sequences & combinations
Primer pairForward primerSequencePosition of 5'endReverse primerSequencePosition of 5'endAmplicon size
1Bncov-193F     CTTACGGTTTCGTCCGTGTT193ncov-1541R     GTGGAACCCAATAGGCACAC15411348
2Bncov-1185F     CGTCACCAAATGAATGCAAC1185ncov-2495R     TTCTGTGGGAAGTGTTTCTCC24951310
3Bncov-2193F     GAGACGGTTGGGAAATTGTT2193ncov-3523R     TTCAACTTGCATGGCATTGT35231330
4Bncov-3172F     TCAACCTGAAGAAGAGCAAGAA3172ncov-4525R     AGCACCATAATCAACCACACC45251353
5Bncov-4173F     CTAAAAAGGCTGGTGGCACT4173ncov-5550R     AGGGTTGTCTGCTGTTGTCC55501377
6Bncov-5192F     CTGGGTAGGTACATGTCAGCA5192ncov-6548R     GATCTGTGTGGCCAACCTCT65481356
7Bncov-6192F     CACCCTCTTTTAAGAAAGGAGCTA6192ncov-7537R     TGTACATTCGACTCTTGTTGCTC75371345
8Bncov-7194F     CCATTTCATCTTTTAAATGGGATT7194ncov-8554R     CCACCCTTAAGTGCTATCTTTG85541360
9Bncov-8179F     GCAAGGGTTTGTTGATTCAGA8179ncov-9506R     TAAAGGCAACTACATGACTGTATTCAC95061327
10Bncov-9169F     CCTTGAAGGTTCTGTTAGAGTGG9169ncov-10456RGAAATTGGGCCTCATAGCAC104561287
11Bncov-10080FCATCTGGTAAAGTTGAGGGTTGT10080ncov-11533RTCTGGCCAAAAACATGACAG115331453
12Bncov-11189FCCTTCTCTTGCCACTGTAGCTT11189ncov-12547RTGCTGATGCATAAGTAAATGTTG125471358
13Bncov-12163FGGCTGTTGCTAATGGTGATTC12163ncov-13547RTCAAAAGCCCTGTATACGACA135471384
14Bncov-13191FCAGTTACACCGGAAGCCAAT13191ncov-14513RTCCTGATTATGTACAACACCTAGCTC145131322
15Bncov-14183FCCAGGGCTTTAACTGCAGAG14183ncov-15544RCCGTGACAGCTTGACAAATG155441361
16Bncov-15167FTGAAATCAATAGCCGCCACT15167ncov-16511RAAACCAAAAACTTGTCCATTAGC165111344
17Bncov-16176FTTCAAGGTATTGGGAACCTGA16176ncov-17551RCGAGGAACATGTCTGGACCTA175511375
18Bncov-17171FCCGCTGTTGATGCACTATGT17171ncov-18533RTTTATACGCACTACATTCCAAGG185331362
19Bncov-18165FACCTGGCATACCTAAGGACA18165ncov-19542RCATCATGTTATAAGCATCGAGATACA195421377
20Bncov-19191FTTGGAATTGCAATGTCGATAG19191ncov-20478RACCTGTTTGCGCATCTGTTA204781287
21Bncov-19966FTGTGCACCACTCACTGTCTT19966ncov-21730RAAGAACAAGTCCTGAGTTGAATG217301764
22Bncov-21360FCAAATCCAATTCAGTTGTCTTCC21360ncov-22705RCCATAACACTTAAAAGTGGAAAATGA227051345
23Bncov-22363FTGGGTTATCTTCAACCTAGGACTT22363ncov-23713RTTTGTGGGTATGGCAATAGAGTT237131350
24Bncov-23384FGGTTGCTGTTCTTTATCAGGATG23384ncov-24735RGAGGTGCTGACTGAGGGAAG247351351
25Bncov-24369FGACTCACTTTCTTCCACAGCAA24369ncov-25712RAGAGAAAAGGGGCTTCAAGG257121343
26Bncov-25354FTGCTCAAAGGAGTCAAATTACATTA25354ncov-26734RAAACAGCAGCAAGCACAAAA267341380
27Bncov-26361FTGTGTGCGTACTGCTGCAA26361ncov-27712RTGCCGCAACAATAAGAAAAA277121351
28Bncov-27361FTGAAGAGCAACCAATGGAGA27361ncov-28719RGGGTGCCAATGTGATCTTTT287191358
29Bncov-28397FGCCCCAAGGTTTACCCAATA28397ncov-29734RGGTGAAAATGTGGTGGCTCT297341337
30Bncov-28397FGCCCCAAGGTTTACCCAATA28397ncov-29871RTGATTTTAATAGCTTCTTAGGAGAATGAC298711474
Table 3. Set B: Primer sequences & combinations
Prepare a PCR mix following Table 4. Thaw and briefly vortex all the required reagents except enzymes. Prepare a mix for ~70 samples (enough for both sets A and B).
Note
Preparation of working dilution of dNTPs (100 mM dNTP Set, Invitrogen, cat 10297018)
Mix the four tubes of dNTPs in one bijou tube. Add 1.5 ml of water to reach concentration of 10 mM (Final volume 2.5 ml). Aliquot in 2 ml tubes with screw cap.


PCR mixX 1 (µl)X 70
Water 35.8 2,506
10X High Fidelity Buffer (Invitrogen) 5.0 350
10 mM dNTPs mix (Invitrogen) See Appendix 1 1.0 70
50mM MgSO4 (Invitrogen) 2.0 140
Platinum Taq DNA Polymerase 5 U/µl (Invitrogen) 0.2 14
Final volume 44.0 3,080
Table 4
Mix with a gentle vortex. Keep on ice. Dispense 44µl of the PCR mix into every well with primers of rows A, B, C, E, F and G.
Pull together all 7 cDNA strip tubes into one and load 4 µl of cDNA in each well.
Cover the 96-well plate with an adhesive lid or strip caps. Spin briefly the plate.
Transfer the 96-well plate to a thermal cycler.
Amplify using the following cycling conditions:
Temperature95 °C Duration00:10:00
followed by 35 cycles of:
Temperature94 °C Duration00:00:30
Temperature52 °C Duration00:00:30
Temperature68 °C Duration00:05:00
Hold at Temperature15 °C


Working in a post-PCR area

Use 1% or 2% E-gels 48 wells (Invitrogen) for visualisation of the bands, following manufacturer’s instructions. For each sample prepare 1x 96-well microtiter plate to mix Loading buffer
Prepare diluted Blue Juice loading buffer. Add 10 µl of diluted Blue Juice to every well of rows A, B, C, E, F and G (mirroring the PCR plate) Use multichannel pipettes.
Note
Preparation of Blue Juice diluted 1/25 or 1/50
Mix 10 ml of buffer TBE with 400 µl (1/25) or 200 µl (1/50) µl of undiluted Blue Juice.

Add 5 µl of sample from the PCR plate to the microtiter plate. Use multichannel pipettes.
Separately, prepare enough mixture of diluted Blue Juice (14µl diluted Blue Juice + 1µl of 1 Kb Plus Ladder) to add to wells marked with M.
Transfer 15 µl of samples and ladder dilutions into the E-gels. Load 15 µl of diluted Blue Juice in empty wells (no wells should be empty). Run for 20 minutes and view under shortwave U.V.
Note
Alternative using multichannel pipette (tips will fit into every other well of 48 wells E-gels): if two samples are run in parallel, load amplicons from sample A in odd wells, and amplicons from sample 2 in even wells. Repeat the procedure with rows B to F. Load 15 µl of the mixture of Blue Juice + Ladder into the wells marked with M at the beginning and end of each gel row. In that way, amplicon 1 of sample A will run next to amplicon 1 of sample B and similarly for each amplicon.


Some examples of gel pictures are shown here:


To prepare equimolar mixes, ideally PCR reactions should be first cleaned up using e.g. silica columns or magnetic beads and then quantified, but the amount or PCR reactions makes this very impractical, unless using automated methods. Instead, rough equimolar mixes are prepared based on brightness of gel bands: 3 µl of a strong band, 5 µl of a normal band, and 10 µl of a weak or non-visible band. Mix the appropriate amount of each amplicon from SET A in
an Eppendorf tube (final volume 60 to 300µl). Do not include the negative control. Repeat the procedure for SET B amplicons in a separate tube.
Perform PCR product purification using QIAquick PCR purification kit columns, following manufacturer’s instructions. Perform repeated additions and spins of the sample until all of it has gone through the column. Elute the purified DNA in 50 µl of molecular grade water.
Run quantitation of DNA using the Qubit dsDNA HS reagent (Life Technologies) and the Qubit fluorometer, according to manufacturer’s instructions.
Dilute the samples to the appropriate concentration for Illumina library preparation using Nextera XT (not described here).