Jan 22, 2026
RT-qPCR-based sex identification in Platynereis dumerilii juveniles
- Rannyele P. Ribeiro1,
- B. Duygu Özpolat1
- 1Washington University in St. Louis
- Platynereis dumerilli protocols
Protocol Citation: Rannyele P. Ribeiro, B. Duygu Özpolat 2026. RT-qPCR-based sex identification in Platynereis dumerilii juveniles. protocols.io https://dx.doi.org/10.17504/protocols.io.ewov1kq3kgr2/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 16, 2026
Last Modified: January 22, 2026
Protocol Integer ID: 238745
Keywords: annelids, sex differentiation, germ cells, RT-qPCR, RNA isolation, sex identification markers for worm, sex identification in platynereis dumerilii juveniles platynereis dumerilii, sex of individual worm, sex identification marker, sex marker gene, detailed method for sex identification, sex identification for those sample, mrna expression of sex marker gene, based sex identification, sex identification, allowing sex identification, platynereis dumerilii juveniles platynereis dumerilii, sex differentiation, experiments with sex, female markers in each individual sample, reverse transcription quantitative polymerase chain reaction, samples with positive sex score, individual worm, female marker, sex score, samples with negative sex score, gel electrophoresis as an accessible method, gel electrophoresi, reverse transcription polymerase chain reaction, quantitative polymerase chain reaction, sex score as the difference, worm, separate sex, using reverse transcription, details of sex, positive sex score, markers with
Funders Acknowledgements:
NIH
Grant ID: R35GM138008
Abstract
Platynereis dumerilii has separate sexes, but as juveniles there are no outside morphological characteristics that help determine the sex of individual worms. It is often important to know whether experimental samples are females or males. Previously, we published sex identification markers for worms that are between 40 and 70 segments (40S-70S) (Ribeiro et al, 2025), where we presented reverse transcription polymerase chain reaction (RT-PCR) and gel electrophoresis as an accessible method. In that study, we also performed preliminary results from RT-qPCRs, yielding encouraging data that informed the development of this fully validated approach described here. In this protocol, we present a detailed method for sex identification using reverse transcription quantitative polymerase chain reaction (RT-qPCR), which is more sensitive, and has higher accuracy. Just as the RT-PCR method, this is also based on mRNA expression of sex marker genes from coelomic contents. These samples can be collected without sacrificing the individual worms, thereby allowing sex identification for those samples and designing experiments with sex as a biological variable accounted for. Details of sex-biased genes used here can be found in our previous work (Ribeiro et al., 2025).
Practical Example
P. dumerilii does not have gonads and instead makes clusters of cells (gonial clusters) that are freely floating in the coelomic cavity (Fischer, 1974, 1975; Kuehn et al., 2022; Meisel, 1990). For sex identification, worms can be amputated at their tail, and coelomic contents including the gonial clusters can be collected for sex identification.
In this example, we collected coelomic contents from amputated tails of P. dumerilii juveniles at the 50-segment and 60-segment developmental stages (50S and 60S). Total RNA was extracted from these samples, and gene expression levels were measured using RT-qPCR.
For each cDNA sample of a worm, we measured the expression of a male-specific marker (dmrt1 - doublesex and mab-3 related transcription factor 1) and a female-specific marker (psmt - protostome specific methyltransferase). Expression values were reported as cycle threshold (Ct) values (Table 1).
To assign sex, we calculate the Sex Score as the difference between the average Ct values of the two markers within the same biological sample: Sex Score = Avg Ct (dmrt1) − Avg Ct (psmt). Samples with positive sex scores are identified as females, whereas samples with negative sex scores are as males.
Because sex differentiation relies on the relative expression of the male and female markers in each individual sample, the difference in Average Ct values between dmrt1 and psmt is equivalent to the difference in their ΔCt values (ΔCt is a traditional normalization method in RT-qPCRs). Therefore, normalization to a housekeeping gene using the ΔCt method is not required for sex identification here. Nevertheless, amplification of 18S rRNA was included as a technical positive control to confirm RNA quality and RT-qPCR performance (Table 1).
| A | B | C | D | E | F | G | H | I | |
| WORM ID | Avg Ct (dmrt1) | Avg Ct (psmt) | Avg Ct (18S) | ∆Ct dmrt1 | ∆Ct psmt | Sex Score | SEX (RT-qPCR) | SEX (RNA-seq) | |
| G11 | 25.8 | 22.09 | 23.95 | 16.34 | 12.63 | 3.71 | female | female | |
| G7 | 27.25 | 24.61 | 25.93 | 13.87 | 11.23 | 2.64 | female | female | |
| G10 | 23.25 | 30.42 | 26.83 | 8.36 | 15.54 | -7.17 | male | male | |
| G12 | 31.7 | 28.28 | 29.99 | 14.37 | 10.95 | 3.42 | female | N/A | |
| G3 | 27.09 | 22.93 | 25.01 | 16.13 | 11.97 | 4.15 | female | female | |
| V4 | 32.41 | 33.13 | 32.77 | 11.8 | 12.52 | -0.72 | male | N/A | |
| V3 | 31.39 | 35.8 | 33.59 | 5.02 | 9.43 | -4.41 | male | N/A | |
| V10 | 21.42 | 28.83 | 25.13 | 3.78 | 11.19 | -7.41 | male | male | |
| V1 | 24.03 | 32.28 | 28.16 | 5.31 | 13.56 | -8.25 | male | male | |
| V5 | 30.53 | 29.31 | 29.92 | 13.08 | 11.87 | 1.22 | female | female | |
| V9 | 30.02 | 28.19 | 29.11 | 14.74 | 12.9 | 1.83 | female | female | |
| G2 | 29.92 | 25.66 | 27.79 | 13.48 | 9.23 | 4.26 | female | female | |
| V6 | 29.64 | 25.89 | 27.77 | 12.81 | 9.05 | 3.75 | female | female | |
| V8 | 24.28 | 30.5 | 27.39 | 7.28 | 13.5 | -6.22 | male | male | |
| V7 | 28.99 | 27.86 | 28.42 | 12.29 | 11.15 | 1.14 | female | female | |
| V12 | 24.61 | 28.71 | 26.66 | 7.47 | 11.58 | -4.1 | male | male |
Table 1: Results of practical example, showing RT-qPCR Ct values for male (dmrt1), female (psmt), and housekeeping (18S) markers in individual worm cDNA samples. dmrt1 primers: Pdu-dmrt.si3.D3-F and Pdu-dmrt.si3.D3-r. psmt primers: Pdu.psmt-b1-F and Pdu.psmt-b1-F. 18S primers: 18S-RPR-F and 18S-RPR-R. Primer sequences are provided in Table 2. N/A: Samples not sequenced.
Image Attribution
Fig. 1: Typical 2-Temp Amp + Melt RT-qPCR cycle used in this protocol.
Fig. 2: Scheme summarizing interpretation of results.
Materials
| A | B | C | D | |
| Category | Item | Notes | Suggested Vendor / Cat number (Cat.) | |
| Consumables | Microcentrifuge tubes | RNase-free | Any laboratory supplier | |
| RT-qPCR plates | Compatible with qPCR instrument | Bio-Rad or equivalent | ||
| Optical plate seals | Microseal | Bio-Rad/ Cat. MSB1001 | ||
| Pipette tips | RNase-free | filtered | ||
| RNA extraction reagents and kits | Arcturus PicoPure RNA isolation Kit | For low-input RNA samples | Applied Biosystems/ Cat. KIT0204 | |
| TRIzol Reagent | For higher-input RNA extraction | Invitrogen/ Cat. 15596026 | ||
| Rneasy Mini Kit | For RNA clean up | Qiagen/ Cat. no. 74104 | ||
| Enzymes / reagents | RNase-Free DNase Set | On-column DNase treatment | Qiagen/ Cat. no. 79254 | |
| cDNA synthesis kit options | 1st Strand cDNA Synthesis Kit for RT-PCR (AMV) | For cDNA synthesis | Sigma-Aldrich/ Cat. no. 11483188001 | |
| High-Capacity RNA-to-cDNA | For cDNA synthesis | Applied Biosystems/ Cat. no. 4387406 | ||
| RT-qPCR master mix | SsoAdvanced Universal SYBR Green Supermix | For RT-qPCR reactions | Bio-Rad/ Cat. No. 1725271 | |
| Molecular biology reagent | Nuclease-free water | For reactions and dilutions | Any laboratory supplier | |
| Equipment | Microcentrifuge | With plate adapters if needed | Any laboratory supplier | |
| Refrigerated centrifuge | Optional for RNA work | Any laboratory supplier | ||
| qPCR instrument | Capable of melt curve analysis | Bio-Rad or equivalent | ||
| NanoDrop or spectrophotometer | For RNA quantification | Thermo Fisher Scientific or equivalent |
Materials required for RT-qPCR-based sex identification in Platynereis dumerilii juveniles described in this study. Suggested vendors are provided for reference; equivalent alternatives may be used.
Troubleshooting
Problem
No amplification or Ct ≥39
Solution
Possible cause: Low RNA input or RNA degradation.
Solution: Verify RNA concentration and integrity; repeat extraction if needed
Problem
High Ct variability between replicates
Solution
Possible cause: Pipetting error or low template amount
Solution: Increase technical replicates; ensure accurate pipetting
Problem
Multiple peaks in melt curve
Solution
Possible cause: Non-specific amplification or primer–dimer formation.
Solution: Exclude affected wells; confirm primer specificity and efficiency
Problem
Sex score close to zero
Solution
Possible cause: Low differential expression or early developmental stage
Solution: Repeat qPCR, wait animal to reach a more progressed developmental stage, or use additional markers
Problem
RT-qPCR result conflicts with morphology
Solution
Possible cause: Transitional gonial state or biological variability
Solution: Re-sample the same animal later or validate using an independent method
Problem
All reactions fail for a gene (NaN Ct values)
Solution
Possible cause: Primer degradation
Solution: Aliquot new primers
Safety warnings
- Indeterminate range: If sex score is close to zero (e.g., -0.5< sex score <0.5) classify the sample as indeterminate and repeat sampling or RT-qPCR.Sex identification is more reliable when results are consistent across independent methods (e.g., gonial cluster morphology and RT-qPCR, or RT-qPCR and RNA-seq).
- Gene expression patterns of sex-specific markers may vary with developmental stages (e.g., 40-segment vs. 60–70-segment animals). Younger worms may show reduced differences in the expression of sex marker genes, which can lead to ambiguous results. See Ribeiro et al. (2025) for additional discussion of stage-dependent expression patterns.
- When possible, include additional sex-specific markers to confirm result consistency.
- If feasible, allow worms to develop clear morphological sex characteristics before sampling. For visual confirmation, use general morphological characteristics of gonial clusters and the stages they go through in females and males. Guidelines for visual gonial cluster staging by our lab are under construction, but you can use the previous literature (Fischer, 1974, 1975; Meisel, 1990).
Step-by-Step Protocol
Gene Selection
Minimum requirement: Select one male-specific gene marker and one female-specific gene marker. We suggest using dmrt1 for males and psmt for females.
Select primers only from the list of RT-qPCR-validated primers provided in Table 2. Primer amplification efficiencies were evaluated under the same RT-qPCR conditions described here (see Step 4) and are reported in Table 3. It is important to note that primers used for RT-qPCR in our previous study (Ribeiro et al., 2025) may show low efficiency in RT-qPCR and should not be used unless validated.
Primer requirements:
- Acceptable efficiency range: 90-110%.
- Expected amplicon size: 70-150 bp depending on primer design.
| A | B | C | D | |
| Primer | Sequence | Tm | Suitability | |
| 18S-RPR-F | TAGAGTGTTCAAGGCAGGCG | 60.04 | PCR/ qPCR | |
| 18S-RPR-R | CCACCAACTAAGAACGGCCA | 60.25 | PCR/ qPCR | |
| Pdu-actin-RPR-F | AAGATCTTGACCGAGCGTGG | 60.11 | PCR/ qPCR | |
| Pdu-actin-RPR-R | GATGGAGCCAAGGCAGTGAT | 60.11 | PCR/ qPCR | |
| Pdu-dmrt1-Q1-F | CGCCCCTGATCAAAGGCCAA | 63.12 | PCR | |
| Pdu-dmrt1-Q1-R | AAGGCTGAACCGAGCTGCTG | 63.07 | PCR | |
| Pdu-dmrt1-Q6-F | TGGCACAAGCATGCAAGCAC | 62.7 | PCR | |
| Pdu-dmrt1-Q6-R | GGCCGACGCTCTCAATGGAT | 62.65 | PCR | |
| Pdu-psmt-Q1-F | CCAGGGCTGTGCCAACATCT | 62.78 | PCR | |
| Pdu-psmt-Q1-R | CGGGATGTGTTCCGCCACTT | 63.08 | PCR | |
| Pdu-psmt-Q4-F | GGATGCTTGCCATGGTTGCC | 62.58 | PCR | |
| Pdu-psmt-Q4-R | CACTCGGCCGTTGCTAACCT | 62.78 | PCR | |
| Pdu-lrcct-Q1-F | ACGGTCTCTCCAACCGACCA | 62.99 | PCR | |
| Pdu-lrcct-Q1-R | TCCCGGAAGTCGGAACCAGT | 63.01 | PCR | |
| Pdu-lrcct-Q2-F | TCCAAGCAGGAGGGGGAGAC | 63.12 | PCR | |
| Pdu-lrcct-Q2-R | AGAAGCCCTGAAGGTCCGGT | 63.04 | PCR | |
| Pdu-kctd21-Q4-F | TTGGGCAACTTGGGCAGACA | 62.58 | PCR | |
| Pdu-kctd21-Q4-R | CAGGCCCAAGGCTGTTGGTA | 62.42 | PCR | |
| Pdu-kctd21-Q5-F | TGGTTGGGCAACTTGGGCAG | 63.56 | PCR | |
| Pdu-kctd21-Q5-R | AATGTTCAGCGACAGGCCCA | 62.41 | PCR | |
| Pdu.psmt-b1-F | TCTGGTGGATGGTGTGAGGA | 60.18 | PCR/ qPCR | |
| Pdu.psmt-b1-R | TAATGGCCACGTCCATCTCC | 59.53 | PCR/ qPCR | |
| Pdu.psmt-b2-F | ATGGTGTGAGGAAACAGCCA | 59.52 | PCR/ qPCR | |
| Pdu.psmt-b2-R | GGCCACGTCCATCTCCAAA | 60 | PCR/ qPCR | |
| Pdu.psmt-si1-m1-F | CATGTCCCTTGAAGTGGCGG | 61.31 | PCR/ qPCR | |
| Pdu.psmt-si1-m1-R | GTCGCACAATGTTGCTCAAGT | 60 | PCR/ qPCR | |
| Pdu.psmt-si1-m2-F | GTCCCTTGAAGTGGCGGAA | 59.93 | PCR/ qPCR | |
| Pdu.psmt-si1-m2-R | GCATGTCGCACAATGTTGCT | 60.39 | PCR/ qPCR | |
| Pdu-dmrt.si1.D1-F | CTTGCCACTACGACCTGGAG | 60.11 | PCR/ qPCR | |
| Pdu-dmrt.si1.D1-R | AGCCTGTTCTTGGGCATGTT | 60.18 | PCR/ qPCR | |
| Pdu-dmrt.si3.D2-F | CGTAATCCGGATGAGAGCCC | 60.04 | PCR/ qPCR | |
| Pdu-dmrt.si3.D2-R | TCGTAGTGGCAAGCCTTCAA | 60.32 | PCR/ qPCR | |
| Pdu-dmrt.si3.D3-F | CCGTAATCCGGATGAGAGCC | 60.04 | PCR/ qPCR | |
| Pdu-dmrt.si3.D3-R | AGCTCGGTTCAGCCTTTTCT | 59.61 | PCR/ qPCR |
Table 2. Primers designed for amplification of target and housekeeping genes.
| A | B | C | D | E | F | G | |
| Target | Forward | Reverse | Ta (°C) | Slope | Efficiency (%) | Best use | |
| psmt | Pdu.psmt-b1-F | Pdu.psmt-b1-R | 60 | -3.5 | 93.07 | RT-qPCR | |
| psmt | Pdu.psmt-b2-F | Pdu.psmt-b2-R | 60 | -3.45 | 94.92 | RT-qPCR | |
| psmt | Pdu.psmt-si1-m1-F | Pdu.psmt-si1-m1-R | 60 | -3.58 | 90.25 | RT-qPCR | |
| psmt | Pdu.psmt-si1-m2-F | Pdu.psmt-si1-m2-R | 60 | -3.47 | 94.17 | RT-qPCR | |
| dmrt1 | Pdu-dmrt.si1.D1-F | Pdu-dmrt.si1.D1-R | 60 | -3.62 | 88.90 | PCR | |
| dmrt1 | Pdu-dmrt.si3.D2-F | Pdu-dmrt.si3.D2-R | 60 | -3.57 | 90.60 | RT-qPCR | |
| dmrt1 | Pdu-dmrt.si3.D3-F | Pdu-dmrt.si3.D3-R | 60 | -3.55 | 91.29 | RT-qPCR | |
| 18S | 18S-RPR-F | 18S-RPR-R | 60 | -3.11 | 110 | RT-qPCR | |
| actin | Pdu-actin-RPR-F | Pdu-actin-RPR-R | 60 | -3.11 | 110 | RT-qPCR | |
| dmrt1 | Pdu-dmrt1-Q1-F | Pdu-dmrt1-Q1-R | 60 | 0.561 | N/A | PCR | |
| dmrt1 | Pdu-dmrt1-Q6-F | Pdu-dmrt1-Q6-R | 60 | 0.357 | N/A | PCR | |
| psmt | Pdu-psmt-Q1-F | Pdu-psmt-Q1-R | 60 | -2.03 | 2.11 | PCR | |
| psmt | Pdu-psmt-Q4-F | Pdu-psmt-Q4-R | 60 | -1.73 | 2.78 | PCR | |
| lrrct | Pdu-lrcct-Q1-F | Pdu-lrcct-Q1-R | 60 | 0.499 | N/A | PCR | |
| lrrct | Pdu-lrcct-Q2-F | Pdu-lrcct-Q2-R | 60 | 0.667 | N/A | PCR | |
| kctd21 | Pdu-kctd21-Q4-F | Pdu-kctd21-Q4-R | 60 | 0.155 | N/A | PCR | |
| kctd21 | Pdu-kctd21-Q5-F | Pdu-kctd21-Q5-R | 60 | 0.144 | N/A | PCR |
Table 3. RT-qPCR primer set efficiency showing annealing temperature (Ta) used in reactions, standard curve slope, amplification efficiency (%), and recommended application for each primer pair. cDNA templates were prepared from RNA isolated from coelomic contents. N/A values represent failure of amplification.
Sample collection
Collection of coelomic contents enriched in gonial clusters and RNA extraction can be performed using the protocols in Ribeiro et al (2025) (file “Gonial Cluster Isolation_RPR.docx”, available at https://github.com/BDuyguOzpolat/Ribeiro-et-al_Sex_Differentiation/blob/main/1.Protocols.zip).
Animals do not need to be sacrificed. Samples may be obtained by surgical removal of a parapodium and gentle squeezing to release coelomic contents, or via amputation and dissection of the posterior body to remove coelomic contents as described in our previous protocol mentioned in step 2.1.
Use only animals with ≥ 40 body segments. Animals with fewer than 40 segments may lack sufficient gonial clusters expressing sex-marker genes, and sex identification may not be reliable. Note that individuals with approximately 50 segments can occasionally yield ambiguous results.
Sample handling parameters:
- Minimum sample amount: depending on gonial cluster abundance; sufficient material should yield ≥1 ng/µL RNA.
- Time from collection to lysis: up to 30 min, room temperature (RT, ~20–22°C).
- Storage conditions and maximum storage time: extract immediately or for long-term storage, preserve cell extract in Pico Pure Extraction Buffer or TRIzol at -70-80℃ until RNA extraction.
RNA Extraction and cDNA Synthesis
Extract total RNA following a protocol including on-column DNase treatment. For samples with fewer cells, for example, samples from parapodium removal and squeeze, we recommend protocol described in Ribeiro et al. (2025) (file: “PicoPure_RNA_extraction.docx”, https://github.com/BDuyguOzpolat/Ribeiro-et-al_Sex_Differentiation/blob/main/1.Protocols.zip).
Note: For samples with higher cell numbers, for example coelomic contents from cut tails, TRIzol-based extraction protocols work fine, provided RNA quality is preserved. A TRIzol-based protocol is available at https://github.com/BDuyguOzpolat/Ribeiro-et-al_Sex_Differentiation/blob/main/Updated_protocols/Trizol_RNA_DNA_isolation_Jan15-2026.pdf.
Synthesize cDNA using the RNA templates. We have tested and recommend 1st Strand cDNA Synthesis Kit for RT-PCR (AMV) (11 483 188 001, Sigma-Aldrich) or High-Capacity RNA-to-cDNA‱ Kit (4387406, Applied Biosystems‱). Use manufacturer instructions for cDNA synthesis.
RNA quality control should respect these parameters.
- RNA concentration (minimum): 1ng/µL.
- RNA purity (A260/280): >1.80, measured using a NanoDrop or equivalent spectrophotometer.
- cDNA template: ~2000ng/µL.
RT-qPCR
Perform RT-qPCR for the selected markers using protocol described by Ribeiro et al (2025): file “RT-qPCR with BioRad SsoAdvanced Universal SYBR Green Supermix.docx”, https://github.com/BDuyguOzpolat/Ribeiro-et-al_Sex_Differentiation/blob/main/1.Protocols.zip.
Prepare mix and primer solutions following the manufacturer instructions.
Reaction setup (BioRad SsoAdvanced Universal SYBR Green Supermix):
- Reaction volume: 20 µL.
- Final cDNA amount per reaction: 100ng-100fg.
- Final concentration of each primer: 0.5 µM.
Mix reactions thoroughly, avoiding bubble formation, and dispense into a compatible RT-qPCR plate.
Seal the plate using specific microseals. We recommend Microseal ‱ ‘B’ (MSB1001, BioRad).
Briefly centrifuge to collect contents at the bottom of wells, and load into the RT-qPCR instrument.
Run RT-qPCR using a two-step amplification protocol followed by melt curve analysis (Fig. 1) with the following cycling conditions.
Cycling conditions: 2-step Amp + Melt (Amplification + Melt Curve).
- Amplification settings: 95°C for 3 minutes (initial denaturation); 39 cycles of 95°C for 10 seconds and 60°C for 30 seconds.
- Melt curve settings: 65°C to 95 °C in 0.5°C increments, with a 5-second hold at each step.
Fig. 1. Typical 2-Temp Amp + Melt RT-qPCR cycle used in this protocol.
Run at least 2 technical replicates per gene (3 recommended).
Controls should be run using the same primer sets as experimental samples.
Include the following controls in each run:
- No-template control (NTC)
- No-reverse transcription control (No-RT)
- Positive control samples (known male and female, if available).
RT-qPCR analysis
Retrieve Ct values from your reactions from the RT-qPCR machine.
For each gene (dmrt1 and psmt) and samples:
- Exclude failed or non-specific wells based on amplification (e.g. NaN Ct results) and melt curve results (e.g. wells showing multiple peaks or abnormal melt profiles).
- Calculate the Average Ct values from accepted technical replicates.
Replicate acceptance criteria
- Maximum allowed Ct variation between replicates: ≤0.5 cycles
- Consider Ct values ≥39 as not detected (NaN).
Identifying sex
Calculate sex score as:
Sex score = Average Ct (Male marker) − Average Ct (Female marker)
Interpret results:
- Negative value: indicates a male sample, because the male marker has a lower Ct (higher expression) than the female marker.
- Positive value: indicates a female sample, because the female marker has a lower Ct (higher expression) than the male marker.
Only the sign of the sex score is used to assign sex. Because Ct is inversely related to expression level, a lower Ct indicates higher expression, while a higher Ct indicates lower expression. This subtraction directly compares the relative abundance of the male and female markers in the same biological sample (Fig. 2).
Fig. 2. Scheme summarizing interpretation of results.
Protocol references
Fischer, A. (1974). Stages and stage distribution in early oogenesis in the annelid, Platynereis dumerilii. Cell and Tissue Research, 156_(1), 35–45. https://doi.org/10.1007/BF00220100
Fischer, A. (1975). The structure of symplasmic early oocytes and their enveloping sheath cells in the polychaete, Platynereis dumerilii. Cell and Tissue Research, 160_(3), 327–343. https://doi.org/10.1007/BF00222043
Kuehn, E., Clausen, D. S., Null, R. W., Metzger, B. M., Willis, A. D., Özpolat, B. D. (2022). Segment number threshold determines juvenile onset of germline cluster expansion in Platynereis dumerilii. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution, 338_(4), 225–240. https://doi.org/10.1002/jez.b.23100
Meisel, J. (1990). Zur Hormonabhängigkeit der Spermatogenese bei Platynereis dumerilii: Licht- und elektronenmikroskopische Befunde sowie experimentelle Untersuchungen in vivo und in vitro_. Ruhr-Universität.
Ribeiro, R. P., Null, R. W., Özpolat, B. D. (2025). Sex-biased gene expression precedes sexual dimorphism in the agonal annelid Platynereis dumerilii. Development, 152_(7), dev204513. https://doi.org/10.1242/dev.204513