Nov 30, 2021

Public workspaceRT–PCR protocol for the detection ORF1 11288–11296 deletion (NSP6 106-108del) in SARS-CoV-2 genome

  • 1Smorodintsev Research Institute of Influenza (St. Petersburg, Russia)
Icon indicating open access to content
QR code linking to this content
Protocol CitationNikita Yolshin, Artem Fadeev, Andrey Komissarov 2021. RT–PCR protocol for the detection ORF1 11288–11296 deletion (NSP6 106-108del) in SARS-CoV-2 genome. protocols.io https://dx.doi.org/10.17504/protocols.io.bvf9n3r6
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: June 01, 2021
Last Modified: November 30, 2021
Protocol Integer ID: 50401
Keywords: SARS-CoV-2, ORF1 deletion, 11288–11296, ORF1del PCR,
Abstract
ORF1 deletion is observed in some new SARS-CoV-2 lineages and is lineage defining for B.1.1.7 and P.1. Biological effect of this mutation is still unknown. Developed RT-PCR was tested on numerous samples of lineages B.1.1.7, B.1.351, P.1 (validated by sequencing) and samples without this mutation with no false-postive results.




Order oligonucleotides with following sequences:

AB
Name Sequence (5’ –> 3’)
ORF1-del-F GGTTGGATATGGTTGATACTAGTTTGAAG
ORF1-del-R TGTCAAGACATTCATAAGTGTCCACA
ORF1-del-P Cy5.5-ACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCC-BHQ3
Briefly vortex and centrifuge reagents before use.
Prepare the PCR reaction mixture following the specifications below:
2X RT-PCR Buffer 12.5 μl
25X RT-PCR Enzyme Mix 1 μl
ORF1-del primers 600 nM each
ORF1-del probe 400 nM
RNA template 5 μl
Nuclease-free water to 25 μl
AgPath-ID™ One-Step RT-PCR Reagents was used in our case
Use SARS-CoV-2 positive samples as the template. In the case of screening of unknown samples use multiplex RT-PCR with some oligonucleotides for detection SARS-CoV-2 as a control reaction. This primer set for SARS-CoV-2 detection can be added to the test without decrease of sensitivity of the ORF1 deletion test:

AB
Name Sequence (5’ – 3’)
2-SARS-CoV-2-ORF-1-F AGAGCTATGAATTGCAGAC
2-SARS-CoV-2-ORF-1-R GGGAAATACAAAATTTGGACA
2-SARS-CoV-2-ORF-1-P FAM-AATTGGCAAAGAAATTTGACACCTTCA-BHQ-1






Perform the amplification in a general thermocycler with appropriate temperature profile:

Read plate at the annealing and elongation step. Developed PCR was validated for Bio-Rad CFX96, but is believed to work well at any thermocycler.

Interprete the results: detection of fluorescence probe “ORF1-del-P” (Cy5 channel in our case) means presence of ORF deletion 11288–11296