Nov 14, 2025

Public workspaceRT-LAMP for Potato Virus Y detection

RT-LAMP for Potato Virus Y detection
  • Md Munir Mostafiz1,
  • Louise McNamara1,
  • Stephen Byrne1
  • 1Teagasc, Crops Science Department
Icon indicating open access to content
QR code linking to this content
Protocol CitationMd Munir Mostafiz, Louise McNamara, Stephen Byrne 2025. RT-LAMP for Potato Virus Y detection. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l21je4g1y/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 14, 2025
Last Modified: November 14, 2025
Protocol Integer ID: 232419
Keywords: lamp assay, aphid, crop sample, lamp
Funders Acknowledgements:
Marie Skłodowska-Curie Actions (MSCA)
Grant ID: 101106698
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
A rapid test was developed primarily to support rapid identification of Potato Virus Y in aphid or crop samples. A colorimetric RT-LAMP assay was developed to detect the presence of Potato Virus Y (PVY).
Troubleshooting
Primers
The primers for RT-LAMP were designed for PVY from the sequence MT264731.1 (Potato virus Y isolate P026).

Primer NameSequence (5' to 3')ScaleDesalting
F3-PVY001ACAGTTTGAGCGTTCTGC25nmSTD
B3-PVY001GAATGTGCTGCCTGGTAT25nmSTD
FIP-PVY001CAATTTCTGTGGAAAAACAGGGAAAATTAAAGGTAGGGACATCATCC25nmSTD
BIP-PVY001GAACGAAAGAGTTTGTTTGGTTGGGTAGTGCTTGTTTCTGTGAT25nmSTD
LB-PVY001GACCAACTTTCAGGAGAAGTATGCA25nmSTD
Primers as ordered from Integrated DNA Technologies (IDT) for Potato virus Y (PVY) assay.
A 10X LAMP primer mix was prepared for the assay according to the following table:
Primer Name10X Stock (µM)1X Reaction (µM)
F3-PVY00120.2
B3-PVY00120.2
FIP-PVY001161.6
BIP-PVY001161.6
LB-PVY00140.4
Preparation of primer mix for Potato virus Y (PVY) assay. This is labelled as PVY001 10X mix.

Gene Fragments
A gene fragment was synthesised for the target region to act as a positive control.

Download LAMP-PVY001.fastaLAMP-PVY001.fasta0B

These were ordered from Integrated DNA Technologies and diluted to 10 ng/μL with IDTE (Concentration 10 millimolar (mM) Tris, Concentration 0.1 µg/µL EDTA). Working solutions for testing were prepared by carrying out serial dilutions of the stock.

RT-LAMP Reaction
Thaw all components at RT and place on ice (WarmStart Colorimetric LAMP 2X Master Mix; 10X LAMP primer mix; Target RNA or gBlock (0.1 ng/μL) controls.
Prepare reaction mix according to table below for the number of target samples (plus positive control(s) and no template and/or negative control(s)):
ComponentAmount (μl)
WarmStart Colorimetric LAMP 2X Master Mix12.5
LAMP Primer Mix (10X) [MAV0001 or PAS0001]2.5
dH2O9
Vortex reaction mix and briefly spin contents down in centrifuge.
Pipette Amount24 µL into PCR 8-strips (e.g. 72.991.002 from Sarstedt) and add Amount1 µL of target RNA, gBlock, control, or water for no-template-control. Mix by pipetting up and down, and briefly centrifuge to collect contents. Confirm that reaction solutions have a bright pink color, which indicates an initial high pH, which is required for a successful pH-LAMP reaction.

Seal reaction vessels.
Incubate at Temperature65 °C in a thermocycler or heating block for 30 minutes.

Remove tubes or vessels from incubation and examine by eye. Positive reactions will have turned yellow while negative controls should remain pink. If color change is not robust, e.g. an orange color is visible, return reactions to Temperature65 °C for an additional Duration00:10:00 . When extending the reaction time it is important to monitor the no-template and negative controls closely to ensure false positive reactions are not present. Color will be visible directly on removal from incubation temperature, but can be intensified by allowing the reaction to cool to room temperature.

The result can be photographed to record the colorimetric results, or simply kept at room temperature in the reaction vessel.


Image of RT-LAMP result - two positive tubes on left (yellow) and two negative tubes on right (pink).