Icon indicating open access to content
QR code linking to this content
Protocol CitationMarta Niedzicka, Stephen Byrne 2025. RT-LAMP for BYV detection. protocols.io https://dx.doi.org/10.17504/protocols.io.261geeo1og47/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 02, 2025
Last Modified: May 07, 2025
Protocol  Integer ID: 125978
Keywords: beet yellows virus, BYV, RT-LAMP, plant virus, detecting beet yellows virus, symptomatic beet samples from ireland, byv genome, lamp for byv detection, symptomatic beet sample, byv detection, virus, byv, rna, easy colorimetric assay, yellow color, total rna, assembled genome, genome
Funders Acknowledgements:
Horizon Europe - Marie Sklodowska-Curie Actions
Grant ID: 101106728
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This protocol describes the process of detecting beet yellows virus (BYV) in plant material utilising a quick and easy colorimetric assay. The starting point is total RNA extracted from the material. The positive results are shown in yellow color, while negative samples stay bright pink - an example of these results is provided at the end of the protocol. The basis for development of the assay was assembly of a BYV genome from symptomatic beet samples from Ireland - the sequence data and assembled genome have been deposited in a public repository.
Materials
WarmStart® Colorimetric LAMP 2X Master MixNew England BiolabsCatalog #M1800
Nuclease-free waterMerck MilliporeSigma (Sigma-Aldrich)


Protocol materials
WarmStart® Colorimetric LAMP 2X Master MixNew England BiolabsCatalog #M1800
Nuclease-free waterMerck MilliporeSigma (Sigma-Aldrich)
Safety warnings
Please read SDS associated with various consumables and kits used in this protocol and wear appropriate PPE. A site specific procedural risk assessment should be carried out prior to introducing this protocol to the lab.
Before start
This protocol assumes that you have already isolated Total RNA from plant material.
Primers
Primers were designed using NEB LAMP Primer design tool: https://lamp.neb.com/#!/
The BYV genome sequence used for the design is deposited in GenBank (accession no. PV593736)
AB
BYV_F3_P243L1AGTCGATGAAAGAGTGATCG
BYV_B3_P243L1AGCAGTGTCAAACTTCTCG
BYV_FIP_P243L1ATGAATAGCACACAGGGCGGTGACGCATTTGGTTCACAG
BYV_BIP_P243L1TTGTACCCTAAAGTTAAGGGTTGGAACAGTTCGCGAATTTGC
BYV_LF_P243L1TCACCACTTTCGTACCCGTACTTA
BYV_LB_P243L1TACGGTAAACTGAAATTTGTGCTGC
Designed primers within ORF1a/b gene of BYV
gBlock sequence ordered and used for testing the primers:
CAAAGTTTTTCGTTATGACCGGTCACGACGTTTTCTTCGTGCCTGACCCTTATAAACTTTTAGTGAAATTGGGAGCTTCTAAGGATGAAGTGGACGATGAGTTTCTGTTTGAAGTGTTCACCTCTTTTCGCGATTTAACGAAAGATTTAGTCGATGAAAGAGTGATCGAACTCTTGACGCATTTGGTTCACAGTAAGTACGGGTACGAAAGTGGTGACACGTACGCCGCCCTGTGTGCTATTCATTGTATTCGTTCAAACTTTTCATCGTTCAAGAAATTGTACCCTAAAGTTAAGGGTTGGGTCGTTCACTACGGTAAACTGAAATTTGTGCTGCGCAAATTCGCGAACTGTTTTCGCGAGAAGTTTGACACTGCTTTCGGCGAAGCGTACTTTCTTACTTACGACGAAGCTTGAGACTGTGTGGTAACTCGGTTGTTGTTTTTGTTTGTTTGTGTGTCTGTAGTCCTACTTCGCGGTGATGGACTGTGTACTCCGCTC


Primer mix
We recommend making stockings of the LAMP primers at a useable concentrations. Here, we suggest a 10X Primer Mix containing all LAMP primers.

ABC
Primer10X Concentration (Stock)1X Concentration (Final)
FIP16 µl1.6 µl
BIP16 µl1.6 µl
F32 µl0.2 µl
B32 µl0.2 µl
Loop F (LF)4 µl0.4 µl
Loop B (LB)4 µl0.4 µl
LAMP Primer Mix

Prepare primer stocks in nuclease free water and store at -20 °C for up to 2 years.

Note: Make primer stock in molecular biology graded water rather than other buffer to avoid carryover of additional buffer to the LAMP reaction
Reaction mix
40m
Thaw all components to be used at Room temperature and place on ice. Vortex briefly to mix thoroughly. Centrifuge to collect material and place On ice .
Components:
  • Target nucleic acid
  • LAMP Primer 10X
  • WarmStart® Colorimetric LAMP 2X Master MixNew England BiolabsCatalog #M1800
  • Nuclease-free waterMerck MilliporeSigma (Sigma-Aldrich)


Prepare reaction mix as described below using Colorimetric LAMP MasterMix, LAMP primers and nuclease-free water (1-3 positions from the table below) for your number of samples. The final volume with target included per sample is 25 µL

AB
WarmStart Colorometric LAMP 2X Master Mix12.5 µl
LAMP Primer Mix 10X2.5 µl
dH2O9 µl
Target (DNA, RNA, or water for NTC)1 µl
Total volume25 µl
Reaction mix per 1 sample - final concentration

Vortex reaction mix and centrifuge to collect material.
Pipet 24 µL per reaction into desired reaction vessels and add 1 µL of sample.
Mix by vortexing or by pipetting if using a plate or similar vessel, centrifuge to collect if necessary.
Check that reaction solutions have a bright pink color, which indicates initial high pH required for successful pH-LAMP reaction.

Seal reaction vessels.
Incubate at 65 °C for 00:30:00 .

30m
Remove tubes or vessels from incubation and examine by eye. Positive reactions will have turned yellow while negative controls should remain pink. If color change is not robust, e.g. an orange color is visible, return reactions to 65 °C for an additional 00:10:00 . Reactions can be examined earlier if desired, and high copy of input reactions can exhibit full color change in as little as 10–15 minutes.
Color will be visible directly on removal from incubation temperature, but can be intensified by allowing reaction to cool to room temperature.

10m
Results
40m
The result can be photographed or scanned to record the colorimetric results, or simply kept at room temperature in the reaction vessel (the colour change remains stable).

Example result after 00:30:00 incubation


Example RT-LAMP results: 6 positive samples, negative sample (RNA from barley infected with BYDV) and NTC