Nov 14, 2025

Public workspaceRT-LAMP for BYDV-PAS and BYDV-MAV detection

  • Md Munir Mostafiz1,
  • Louise McNamara2,
  • Stephen Byrne3
  • 1Teagasc, Crops Research Centre, Oak Park, Carlow R93 XE12;
  • 2Teagasc;
  • 3Teagasc Crop Science Department
Icon indicating open access to content
QR code linking to this content
Protocol CitationMd Munir Mostafiz, Louise McNamara, Stephen Byrne 2025. RT-LAMP for BYDV-PAS and BYDV-MAV detection. protocols.io https://dx.doi.org/10.17504/protocols.io.6qpvr9w33vmk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: February 11, 2025
Last Modified: November 14, 2025
Protocol Integer ID: 119958
Keywords: RT-LAMP, BYDV, general bydv testing of aphid, presence of luteovirus pashordei, bydv species, luteovirus pashordei, luteovirus, lamp for bydv, general bydv testing, aphid, mav detection, lamp assay, bydv, trap samples for rapid surveillance, qc of lab colony, lab experiment, mav, starting lab experiment
Funders Acknowledgements:
Marie Skłodowska-Curie Actions (MSCA)
Grant ID: 101106698
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
A rapid test was developed primarily to support QC of lab colonies, and testing colonies prior to starting lab experiments. It could also be utilised for general BYDV testing of aphids from trap samples for rapid surveillance. An RT-LAMP assay was developed to detect the presence of Luteovirus pashordei (BYDV-PAS) and Luteovirus mavhordei (BYDV-MAV) in samples - these are the two BYDV species routinely utilised in our lab experiments.
Troubleshooting
Safety warnings
While the assay was designed to detect BYDV-MAV - it will also likely detect BYDV-PAV. The assay was designed in target regions to distinguish between BYDV-MAV and BYDV-PAS.
Primers
The primers for RT-LAMP were designed for Luteovirus mavhordei from the sequence OQ686659, and for Luteovirus pashordei from the sequence OQ686684.

Primer NameSequence (5' - 3')ScaleDesalting
F3-MAV001ACAGCTTCACAGAGGTCAAG25nmSTD
B3-MAV001ATGGTGGCAAGAGACAGTTC25nmSTD
FIP-MAV001TTCCATGATGGGCTCGAGGTGTGCCTCATGAAGGAGGTCGT25nmSTD
BIP-MAV001GCCGCCTCCACCTGGATAACATCTGCGTTAAGCGTTGAGT25nmSTD
LF-MAV001TCTTCTTCGCCGTTCTTCTCCT25nmSTD
Primers as ordered from Integrated DNA Technologies (IDT) for Luteovirus mavhordei (BYDV-MAV) assay.

Primer NameSequence (5' - 3')ScaleDesalting
F3-PAS001GGGTTTTTAGAGGGGCTCTG25nmSTD
B3-PAS001TGTCCCCCTTACCAACTGTA25nmSTD
FIP-PAS001CGGGCTCCGTCTGTGACCTTAAGCCTCCTCCGGTTTTGAAAG25nmSTD
BIP-PAS001CCTAACCCAAACCCACCTCGGCTGCAACCAAGGCATTGTG25nmSTD
LF-PAS001CCGGCAGTCCTAATAGAGAAAAGG25nmSTD
LB-PAS001GGTATACAAAGCCCCAAACGCC25nmSTD
Primers as ordered from Integrated DNA Technologies (IDT) for Luteovirus pashordei (BYDV-PAS) assay.

A 10X LAMP primer mix was prepared for each of the two assays according to the following tables:
Primer Name10X stock (µM)1X reaction (µM)
F3-MAV00120.2
B3-MAV00120.2
FIP-MAV001161.6
BIP-MAV001161.6
LF-MAV00140.4
Preparation of primer mix for Luteovirus mavhordei (BYDV-MAV) assay. This is labelled as MAV001 10X mix.
Primer Name10X stock (µM)1X stock (µM)
F3-PAS00120.2
B3-PAS00120.2
FIP-PAS001161.6
BIP-PAS001161.6
LF-PAS00140.4
LB-PAS00140.4
Preparation of primer mix for Luteovirus pashordei (BYDV-PAS) assay. This is labelled as PAS001 10X mix.

Gene Fragments
A gene fragment was synthesised for each target region to act as a positive control.

Download gBlocks.txtgBlocks.txt0B

These were ordered from Integrated DNA Technologies and diluted to 10 ng/ μl with IDTE (Concentration10 millimolar (mM) Tris, Concentration0.1 µg/µL EDTA). Working solutions for testing were prepared by carrying out serial dilutions of the stock.  

RT-LAMP Reaction
Thaw all components at RT and place on ice (WarmStart Colorimetric LAMP 2X Master Mix; 10X LAMP primer mix; Target RNA or gBlock (0.1 ng/μl) controls.
Prepare reaction mix according to table below for the number of target samples (plus positive control(s) and no template and/or negative control(s)):

ComponentAmount (μl)
WarmStart Colorimetric LAMP 2X Master Mix12.5
LAMP Primer Mix (10X) [MAV0001 or PAS0001]2.5
dH2O9
Vortex reaction mix and briefly spin contents down in centrifuge.

Pipette Amount24 µL into PCR 8-strips (e.g. 72.991.002 from Sarstedt) and add 1 µl of target RNA, gBlock, control, or water for no-template-control. Mix by pipetting up and down, and briefly centrifuge to collect contents. Confirm that reaction solutions have a bright pink color, which indicates an initial high pH, which is required for a successful pH-LAMP reaction.
Seal reaction vessels.
Incubate at Temperature65 °C in a thermocycler or heating block for 30 minutes.
Remove tubes or vessels from incubation and examine by eye. Positive reactions will have turned yellow while negative controls should remain pink. If color change is not robust, e.g. an orange color is visible, return reactions to 65°C for an additional 10 minutes. When extending the reaction time it is important to monitor the no-template and negative controls closely to ensure false positive reactions are not present. Color will be visible directly on removal from incubation temperature, but can be intensified by allowing the reaction to cool to room temperature.
The result can be photographed to record the colorimetric results, or simply kept at room temperature in the reaction vessel.