Icon indicating open access to content
QR code linking to this content
Protocol CitationNadiya Khyzha 2022. RT&Tag (Reverse Transcribe & Tagment). protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9jyjqg3e/v1
Manuscript citation:
https://www.nature.com/articles/s41592-022-01618-9
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 27, 2020
Last Modified: October 05, 2022
Protocol  Integer ID: 43870
Keywords: RT&Tag, RNA, RNA-chromatin, tagment rna, tn5 transposase fusion protein, tn5 transposase fusion protein in situ, reverse transcription, reverse transcribe, tn5 transposase, ability of the tn5 transposase, localized reverse transcription, transcribe, sequencing read, rt, sequencing library, tagmentation, rna, drosophila cell, tagment, tag, cdna hybrid, reads per sample
Abstract
Reverse Transcribe & Tagment (RT&Tag) is a method that capitalizes on the ability of the Tn5 transposase to tagment RNA-cDNA hybrids. RT&Tag bypasses immunoprecipitation and instead uses antibodies to tether a protein A-Tn5 transposase fusion protein in situ. By performing localized reverse transcription and tagmentation, one can capture RNAs associated with an epitope of interest within intact nuclei. With RT&Tag, one can generate sequencing libraries using only 100,000 Drosophila cells and require only 8 million sequencing reads per sample.



Materials
Solutions

  • 1 M Hydroxyethyl piperazineethanesulfonic acid (HEPES) pH 7.9 (Sigma-Aldrich Cat# H3375)
  • 1 M Potassium Chloride (KCl) (Sigma-Aldrich Cat# P3911)
  • 1 M Manganese Chloride (MnCl2) (Sigma-Aldrich Cat# M5005)
  • 1 M Calcium Chloride (CaCl2) (Fisher Cat# BP510)
  • 10% Triton X-100 (Sigma-Aldrich Cat# X100)
  • 2 M Spermidine (Sigma-Aldrich Cat# S0266)
  • Glycerol (Sigma-Aldrich Cat# G5516)
  • 1 M Hydroxyethyl piperazineethanesulfonic acid (HEPES) pH 7.5 (Sigma-Aldrich Cat# H3375)
  • 5 M Sodium chloride (NaCl) (Sigma-Aldrich Cat# S3014)
  • 0.5 M Ethylenediaminetetraacetic acid (EDTA) (Research Organics Cat# 3002E)
  • 30% Bovine Serum Albumen (BSA) (Sigma-Aldrich Cat# A8577)
  • 1 M N-[Tris(hydroxymethyl)methyl]-3-aminopropanesulfonic acid (TAPS) pH 8.5 (Millipore Sigma Cat# T5130)
  • 10% Sodium dodecyl sulfate (SDS) (Sigma-Aldrich Cat# L4509)
  • 1 M tris(hydroxymethyl)aminomethane (Tris-HCl) pH 8.0 (Research Organics Inc Cat# 30960T)
  • 80% Ethanol (Fisher Scientific 04-355-223)


Buffer Recipes

  • Binding Buffer (Can store @4C for 6 months)
ReagentVolume
1M HEPES-KPH pH7.9200ul
1M KCl100ul
1M CaCl210ul
1M MnCl210ul
WaterBring up to 10ml

  • NE1 Buffer (Can store @4C for 1 week after adding spermidine and Protease Inhibitor Tablet)
ReagentVolume
1M HEPES-KOH pH7.91ml
1M KCl500ul
10% Triton X-100500ul
100% glycerol10ml
2M spermidine12.5ul
Roche Complete Protease Inhibitor EDTA-Free Tablet1 tablet
WaterBring up to 50ml

  • Wash Buffer (Can store @4C for 1 week after adding spermidine and Protease Inhibitor Tablet)
ReagentVolume
1M HEPES-KOH pH7.51ml
5M NaCl1.5ml
2M spermidine12.5ul
Roche Complete Protease Inhibitor EDTA-Free Tablet1 tablet
WaterBring up to 50ml

  • Antibody Buffer (Can store @4C for 1 week)
ReagentVolume
Wash Buffer1.985ml
0.5M EDTA8ul
30% BSA6.7ul

  • 300Wash Buffer (Can store @4C for 1 week after adding spermidine and Protease Inhibitor Tablet)
ReagentVolume
1M HEPES-KOH pH7.51ml
5M NaCl3ml
2M spermidine12.5ul
Roche Complete Protease Inhibitor EDTA-Free Tablet1 tablet
WaterBring up to 50ml

  • Post-tagmentation Wash Buffer
ReagentVolume
1M TAPS pH8.510ul
Water990ul

  • SDS Release Buffer (Make fresh each time)
ReagentVolume
1M TAPS pH8.510ul
10% SDS10ul
Water980ul

  • Triton X-100 Neutralization Buffer (Make fresh each time)
ReagentVolume
10% Triton X-10067ul
Water933ul



Reagents

  • Rnasin Rnase Inhibitor (Promega N2515)
  • Roche Complete Protease Inhibitor EDTA-Free tablets (Sigma-Aldrich Cat# 5056489001)
  • Concanavalin A (ConA)-coated magnetic beads (Bangs Laboratories Cat # BP531)
  • Antibody to an epitope of interest. Given that in situ binding conditions mimic that of immunofluorescence (IF), we suggest using IF-tested antibodies.
  • Streptavidin Conjugation Kit- Lightning-Link (Abcam Cat# ab102921)
  • Guinea pig α-rabbit secondary antibody (Antibodies online Cat# ABIN101961)
  • Biotinylated- Oligo d(T)-ME B (Manufactured by IDT. Resuspend in water to make a 12.5uM working solution.)
(/5Biosg/GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN)
  • Protein A–Tn5 (pA-Tn5) fusion protein (Can be generated using the following protocol: https://www.protocols.io/view/3xflag-patn5-protein-purification-and-meds-loading-j8nlke4e5l5r/v1)
  • Mosaic end_reverse [PHO]CTGTCTCTTATACACATCT
  • Mosaic end_Adapter A TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
  • Thermo Scientific Maxima H Minus Reverse Transcriptase (Thermo Scientific Cat# EP0751)
  • NEBNext® High-Fidelity 2X PCR Master Mix (NEB Cat# M0541S)
  • PCR primers (10 µM stock solutions of a universal i5 primer and i7 primers with unique barcodes [Buenrostro, J.D. et al. Nature 523:486 (2015)] in 10 mM Tris pH 8)
  • AMPure XP reagent (Beckman Coulter Cat# A63880)




Reagent Preparation

  • Tn5-ME A adapter complex
Dilute the mosaic end_Adapter A and mosaic end_reverse oligonucleotides to 200μM in annealing buffer (10mM Tris pH8, 50mM NaCl, 1mM EDTA). Then take 8μl of each re-suspended oligonucleotide and mix together in a tube. Incubate at 95C for 5min on a heatblock. Then remove heatblock from the heat source and allow to cool to room temperature for ~45min. Once cool, combine with 100μl of 5.5μM protein A-Tn5 fusion protein and place on a rotating platform for 1hr at room temperature. Store at -20C until use.

  • Streptavidin conjugated secondary antibody
Use the guinea pig anti-rabbit secondary antibody and the streptavidin conjugation kit- lightning link. Dilute secondary antibody to 1ug/ul in PBS and then add 10ul of Modifier Reagent. Mix. Then add the secondary antibody to the streptavidin mix. Mix. Incubate for 3hrs in the dark. Then add 10ul of Quencher Reagent. Mix. Incubate for 30min in the dark. The secondary antibody is now streptavidin conjugated and ready for use. Store @4C in the dark until use.





Equipment

  • 1.5ml Eppendorf tubes
  • PCR Rigid 8-tube strips with individually attached flat caps, clear, 0.2ml (BrandTech Cat# P1200)
  • 0.2 ml PCR 8 Strip Magnetic Separator (Permagen Labware MSRLV08)
  • Magnet that fits 1.5ml Eppendorf tubes
  • PCR machine
  • Centrifuge
  • Vortex
Clean desk and prepare reagents
10m

Video
  1. Prepare all buffers and reagents.
Prepare Concanavalin A beads
10m
  1. Mix the Concanavalin A (conA) bead slurry. Transfer 5μl of beads per sample into a 1.5ml eppendorf tube.
  2. Wash with 1ml of Binding Buffer.
  3. Place on magnet and remove the Binding Buffer.
  4. Perform a second wash with 1ml of Binding Buffer.
  5. Resupend in 5μl of Binding Buffer per sample.
  6. Aliquot 5μl of ConA beads into 8-tube PCR strips.

Video

Prepare nuclei
1h
  1. Harvest 4 million S2 cells.
  2. Centrifuge for 3min at 600g. Remove media.
  3. Re-suspend in 1ml of Wash Buffer.
  4. Centrifuge for 3min at 600g. Remove Wash Buffer.
  5. Re-suspend in 500μl of NE1 buffer supplemented with Rnasin Rnase Inhibitor (1U/μl, 1:40 dilution). Immediately place on ice and incubate for 10min.
  6. Centrifuge for 5min at 2500g. Remove NE1 Buffer.
  7. Re-suspend in 500μl of Wash Buffer supplemented with Rnasin Rnase Inhibitor (1U/μl, 1:40 dilution).
  8. Add 100k nuclei into each of 8-tube PCR strips. Incubate for 10min at room temperature to allow nuclei to bind to beads.

Video

Primary antibody binding
1h 15m
  1. Prepare Primary Antibody Master Mixes. Use 50μl of Antibody Buffer per reaction. Dilute antibody of interest 1:100 in Antibody Buffer. Supplement with Rnasin Rnase Inhibitor (1U/μl, 1:40 dilution).
  2. Place the PCR strips on a magnet and remove liquid from the nuclei binding step.
  3. Re-suspend beads in 50μl of Primary Antibody Master Mix while gently vortexing.
  4. Place on a nutator and incubate for 2h at room temperature or overnight at 4°C.

Video

Streptavidin conjugated secondary antibody binding
1h
  1. Prepare Secondary Antibody Master Mixes. Use 50μl of Wash Buffer per reaction. Dilute streptavidin conjugated secondary antibody 1:100 in Wash Buffer. Supplement with Rnasin Rnase Inhibitor (1U/μl, 1:40 dilution).
  2. Place the PCR strips on a magnet and remove the liquid.
  3. Re-suspend beads in 50μl of Secondary Antibody Master Mix while gently vortexing.
  4. Place on a nutator and incubate for 45min at room temperature or overnight at 4°C.

Video

Video

Biotinylated Oligo(dT)-ME-B binding
35m
  1. Prepare Biotinylated Oligo(dT)- ME-B Master Mixes. Use 50μl of Wash Buffer per reaction. Dilute biotinylated Oligo(dT)- ME-B (12.5uM) 1:50 in Wash Buffer. Supplement with Rnasin Rnase Inhibitor (1U/μl, 1:40 dilution).
  2. Place the PCR strips on a magnet and remove the liquid.
  3. Perform 2 sets of washes using 200μl of Wash Buffer.
  4. Re-suspend beads in 50μl of Biotinylated Oligo(dT)- ME-B Master while gently vortexing.
  5. Place on a nutator and incubate for 20min at room temperature.
Protein A-Tn5 binding
1h 15m
  1. Prepare Protein A-Tn5 Master Mixes. Use 50μl of 300Wash Buffer per reaction. Dilute protein A-Tn5 loaded with ME-A 1:200 in 300Wash Buffer. Supplement with Rnasin Rnase Inhibitor (1U/μl, 1:40 dilution). The protein A-Tn5 dilution may need to be established empirically based on the activity level of purified protein A-Tn5.
  2. Place the PCR strips on a magnet and remove the liquid.
  3. Perform 2 sets of washes using 200μl of Wash Buffer.
  4. Re-suspend beads in 50μl of Protein A-Tn5 Master Mix while gently vortexing.
  5. Place on a nutator and incubate for 1h at room temperature.

Reverse Transcription & Tagmentation
2h 15m
  1. Prepare reverse transcription master mix by combining per reaction:
ReagentVolume
5x Reverse Transcription Buffer 4 μL
dNTP Mix (10mM) 1 μL
Maxima Reverse Transcriptase 1 μL
Rnasin RNAse Inhibitor (40U/μL) 0.5 μL
Water 13.5 μ
2. Place the PCR strips on a magnet and remove the liquid.
3. Perform 2 sets of washes using 200μl of 300Wash Buffer.
4. Re-suspend beads in 20μl of Reverse Transcription Master Mix while gently vortexing.
5. Incubate for 2h at 37C in a PCR machine.
Tn5 release
1h 15m
  1. Place the PCR strips on a magnet and remove the liquid.
  2. Perform a wash using 50μl of Post-tagmentation Wash Buffer.
  3. Add 5μl of SDS Release Buffer to each PCR tube. Don't mix or resuspend by vortexing as the bead solution will be quite sticky at this point.
  4. Incubate for 1h at 58C in a PCR machine.
Amplifying libraries
45m
  1. Set-up PCR reaction master mix by combining per reaction:

ReagentVolume
2x NEBNext PCR Master Mix25 μl
Triton X-100 Neutralization Buffer15 μl
10 µM barcoded i5 primer2 μl
2. Add 42 µl of PCR reaction master mix to each sample.
3. Add 2 µl of corresponding 10 µM barcoded i7 primer to each sample.
4. Perform PCR using the following conditions:
ABCDE
Cycle number Denature Anneal Extend Final
1 58° C, 5 min
72° C, 5 min
2 98° C, 30 s
3–14 98° C, 10 s 60° C, 15 s
15 72° C, 1 min
16 4° C, hold

Library clean-up
30m
  1. Perform library clean-up using x0.8 AMPure XP beads. To do so mix the 50µl PCR reaction with 40µl of AMPure XP beads in PCR tubes. Vortex at full speed and centrifuge.
  2. Allow to incubate for 5-10min.
  3. Place the PCR tubes on a magnet and allow a few minutes for beads to gather.
  4. Remove the liquid and perform 2 rounds of washes with 200 µl of 80% ethanol while still on magnet.
  5. Perform a quick centrifuge to gather the remaining ethanol. Place back on magnet and use a 20 µl pipette to remove the residual ethanol.
  6. Re-suspend the beads in 22 µl of 10mM Tris-HCl. Vortex to mix, centrifuge, and allow to incubate for 5-10min.
  7. Place on magnet and transfer the final sample to a clean tube.
Tapestation
20m
  1. Combine 2 µl of sample with 2µl of sample dye and run on D5000 Tapestation to get library size distribution.
  2. Expected library size should be between 200-700bp.
Example of a successful RT&Tag library.
3. If large peak around 150bp is observed, perform an additional round of x0.8 AMPure XP bead clean-up.