Jul 21, 2023

River water laboratory processing Protocol

  • 1Dhulikhel Hospital;
  • 2UC Berkeley
Icon indicating open access to content
QR code linking to this content
Protocol CitationSneha Shrestha, Christopher LeBoa 2023. River water laboratory processing Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.261ge3mxol47/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 21, 2023
Last Modified: July 21, 2023
Protocol  Integer ID: 80906
Keywords: river water laboratory processing protocol, paratyphi qpcr, qpcr condition, river water, laboratory, environmental surveillance, lab team, protocol
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
These are the qPCR conditions used for the S. Typhi and Paratyphi qPCR used for environmental surveillance by our lab team
Materials
Microbiology Laboratory:
(Amount of materials required for a month of sampling)
1. 0.5% sodium hypochlorite
2. 70% ethanol
3. Sterile D/W
4. 15ml Falcon tubes (48 tubes)
5. 50ml Falcon tubes (24 tubes)
6. Sterile, clear glass tubes 7. 1ml sterile tips (2 boxes) and pipette 8. 200μl sterile tips (2 boxes) and pipette 9. Selenite F broth (10ml in each tube, 29 tubes) 10. Sterile 1.5ml eppendorf tubes (116 eppendorfs) a. DNA Zap solution A and B 11. DNA extraction kit (DNEasy Blood and Tissue Kit Cat# 69504)

Molecular Laboratory: 1. 0.5% sodium hypochlorite 2. 70% ethanol 3. Master mix (TaqMan Environmental Mastermix) 4. Primer F (ST/SPTA) 5. Primer R (ST/SPTA) 6. Probe (ST/SPTA) 7. dH2O 8. Template DNA 9. Sterile eppendorf 10. PCR strips 11. 10μl tips (3 boxes) and pipette 12. 20μl sterile tips (1 box) and pipette 13. 200μl sterile tips (1 box) and pipette 14. 1ml sterile tips (1 box) and pipette

qPCR Conditions

List of primer and probes used:  
Salmonella Typhi:
Salmonella Typhi Forward Primer-5' CGCGAAGTCAGAGTCGACATAG 3'
Salmonella Typhi Reverse Primer -5' AAGACCTCAACGCCGATCAC 3'
Salmonella Typhi Probe-5' FAM-CATTTGTTCTGGAGCAGGCTGACGG-BHQ1a-Q3'

Salmonella Paratyphi-A: 
Salmonella Paratyphi-A Forward Primer - 5'ACGATGATGACTGATTTATCGAAC 3'
Salmonella Paratyphi-A Reverse Primer - 5' TGAAAAGATATCTCTCAGAGCTGG 3'
Salmonella Paratyphi-A Probe-5' FAM-CCCATACAATTTCATTCTTATTGAGAATGCGC-BHQ1a-Q 3'

Master mix setup
Salmonella Typhi/Paratyphi-A qPCR:  
AB
Master mix (TaqMan Environmental Mastermix) (2x)10 μl
Primer F (10µM)0.80 μl (400nM)
Primer R(10µM)0.80 μl (400nM)
Probe (10µM)0.4 μl (200nM)
Nuclease Free Water4 μl (DNase/RNase-Free)
Template
Total20 ul


Cycling parameters:
Encode these temperatures onto qPCR machine
15 min at 95°C (Holding stage)
30 secs at 95°C (Cycling Stage) 
30 secs at 60°C (Cycling Stage) 


Initial Denaturation15 min at 95C
Dentaturation30 secs at 95C45 cycles
Annealing and Extension (Fluorescence Capture Step)30 sec at 60C


PCR Result:
  1. Export Ct value results from qPCR machine
  2. Upload results into excel file.
  3. Upload the file to the RedCap app.

Turbidity Testing
2ml of sample (from 5ml separated for Phage Screening) is taken in a sterile glass tube
Turbidity is measured by densitometry.
Differential Centrifugation
Spin down 45ml of collected water sample at 2000rpm for 1 min to separate out larger debris.
Transfer the supernatant to a new sterile 50ml tube.
Centrifuge at 4000rpm for 25mins.
Discard the supernatant and resuspend the pellet in 0.5ml of sterile D/w.
Enrichment and DNA extraction
Transfer 0.5ml of resuspended pellet into 10ml of Selenite F broth.
Transfer 1ml of this suspension to a sterile 1.5ml tube for DNA extraction for T0.
Incubate the inoculated Selenite F broth overnight (16hrs) at 37°C.
At the end of incubation, transfer 1ml of the o/n growth to 1.5ml tube for DNA extraction at T16.
DNA extraction (DNEasy Blood and Tissue Kit Cat# 69504)
Transfer 1ml of bacterial suspension in SF broth to 1.5ml tube.
Centrifuge at 2000rpm for 2mins.
Discard the Supernatant.
Resuspend pellet in 200 μl PBS.
Add 20 μl proteinase K.
Add 200 μl buffer AL. Mix thoroughly by vortexing.
Incubate for 10mins at 55°C.
Add 200 μl ethanol (96-100%) and mix thoroughly by vortexing.
Transfer the mixture into a DNeasy Mini spin column placed in a 2ml collection tube. Centrifuge at 8000rpm for 1min. Discard the flow-through and replace a new collection tube.
Add 500 μl Buffer AW1 to the column and centrifuge at 8000rpm for 1 min. Discard flow-through and replace a new collection tube.
Add 500 μl Buffer AW2 to the column and centrifuge at 14000 rpm for 3 mins. Discard flow-through.
Transfer the collection tube to a new 1.5ml microcentrifuge tube.
Elute the DNA by adding 60 μl Buffer AE to the center of the spin column membrane. Incubate for 1 min at room temperature. Centrifuge at 8000 rpm for 1 min.
Real time PCR (Adapted from Tran Vu Thieu Nga)
Primer preparation Primers/probes are shipped in lyophilized form and need to be constituted with TE buffer or nuclease free dH2O. Make the primary primer/probe stock solution of 100 μM. Amount of nuclease free dH2O= 10 µl × X ng Here, X is the amount of primer/probe provided by the manufacturer. Generally, use the following formula to find unknown volume or concentration. C1*V1 = C2*V2 Where, C1 = Initial concentration. V1 = Initial volume. C2 = Final concentration. V2 = Final volume. Here, for this protocol, we used a portion of the 100 μM primers/probes to make 10 μM/μl solutions to use as working solutions. Aliquot the working solution into 5 separate tubes and store at -20 °C to avoid contamination and multiple freeze-thawing cycles.
Master mix setup
Master mix hi/Paratyphi-A qPCR: