Mar 12, 2026

RETrace2: optimized dual-omic profiling of homopolymer lineage markers and DNA methylation

  • Pin-Chung Cheng1,2,
  • Kun Zhang1
  • 1Altos Labs San Diego Institute of Science, San Diego, CA, USA;
  • 2Division of Biological Sciences, University of California, San Diego, La Jolla, CA, USA
Icon indicating open access to content
QR code linking to this content
Protocol Citation: Pin-Chung Cheng, Kun Zhang 2026. RETrace2: optimized dual-omic profiling of homopolymer lineage markers and DNA methylation. protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvmb12bg3p/v1
Manuscript citation:
Cheng P-C, Kamenev D, Kameneva P, Fitzpatrick C, Adameyko I, Kharchenko PV, Zhang K. High-resolution retrospective single cell lineage tracing with mutable homopolymers. bioRxiv 2026.03.10.709901; doi: https://doi.org/10.64898/2026.03.10.709901 (2026).
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 29, 2025
Last Modified: March 12, 2026
Protocol  Integer ID: 231112
Keywords: RETrace2, Single-cell lineage tracing, microsatellite, homopolymer, somatic mutation, multi-omics, DNA methylation, microsatellite instability, MSH2, mouse model, phylogenetics, RETrace, omic profiling of homopolymer lineage marker, homopolymer lineage marker, using somatic microsatellite mutation, somatic microsatellite mutation, omic library preparation method for retrospective lineage, dna methylation this protocol detail, microsatellite library, dna methylation, homopolymer repeat, fidelity polymerase, substantial optimization of retrace v1, retrace v1, targets per cell pair, targets per cell, step instructions for cell lysi, retrace2, omic library preparation method, retrospective lineage, round hybridization capture, methylation, same starting cell, improved cell lysis buffer, lineage, cell pair, informative mononucleotide, benchmark cell line
Abstract
This protocol details RETrace2, a single-cell dual-omic library preparation method for retrospective lineage tracing using somatic microsatellite mutations. It provides step-by-step instructions for cell lysis, restriction digestion, adapter ligation, and an initial amplification, after which the library is split. The microsatellite (lineage) library is created using a single-round hybridization capture to enrich for homopolymer repeats. The methylation (cell type) library is separately prepared using bisulfite conversion and amplification. The protocol yields two distinct, sequence-ready libraries from the same starting cell, with the microsatellite library achieving a median of over 35,000 targets per cell in benchmark cell lines. This protocol (RETrace2) is a substantial optimization of RETrace v1. Key changes include: targeting highly informative mononucleotide (homopolymer) repeats; an improved cell lysis buffer; switching to a higher-fidelity polymerase (SeqAMP); a ~75% reduction in total PCR cycles; and an expanded, optimized probe set now used with a universal blocker. These optimizations culminate in a ~21-fold increase in the median number of targets captured per cell and ~98-fold increase in shared targets per cell pair.
RETRACE2 LIBRARY PREPARATION OVERVIEW
RETrace v2 Protocol (5-6 working days)
Note: Below is an example, can adjust time and order depending on your schedule.
Day 0: Single cell/nuclei sorting and Lysis (7 hr)
Day 1: Restriction enzyme digestion and A-tailing (4 hr) + Adapter ligation (1 hr) + Single primer PCR (2 hr)
Day 2: Methylation part I (8 hr)
Day 3: Methylation part II + QC (3 hr)
Day 4: Microsatellite PCR + QC (3 hr) + Hybridization capture part I (overnight)
Day 5: Hybridization capture part II + QC (4 hr)

RETrace v2 Probe Production
Day 1: Expansion PCR (3 hr) + T7 RNA transcription (overnight)
Day 2: Reverse Transcription and RNase H Digestion (6 hr)
MATERIALS
You can also find them in the RETrace2 manuscript supplementary file.
Reagent list:
ABCD
Item descriptionVendorCatalog #Note
Eppendorf twin.tec PCR Plate 96, divisible, unskirted, divisible, 250 µL, PCR clean, colorless, 20 platesEppendorf30133374
Eppendorf twin.tec PCR Plate 96 LoBind, semi-skirted, 250 µL, PCR clean, colorless, 25 platesEppendorf30129504LoBind plate has better DNA recovery rate
Triton X-100, for molecular biologySigmaT8787-50ML
QIAGEN Protease (7.5 AU)Qiagen19155
QIAGEN Protease Solvent (6.0 ml)Qiagen1021055
Unmethylated Lambda DNAPromegaD1521
Tris-EDTA buffer solution, 100X, 100mLSigmaT9285-100ML
Potassium chloride solution (KCl; 1 M)Sigma60142-100ML-F
dATP (100mM), 25 µmolNEBN0440S
Deoxynucleotide (dNTP) Solution Set (100mM)NEBN0446S
NEBNext® Multiplex Oligos for Enzymatic Methyl-seq (24 rxn)NEBE7140S
MseI (10U/ul), 1500 U (Thermo ER0982)FisherFERER0982
MspI (100U/ul), 25,000 unitsNEBR0106M
Klenow exo- (5U/ul) (Thermo EP0422)FisherFEREP0422
NEBNext® Ultra™ II Ligation Module (24 rxn)NEBE7595S
HotStart PCR Kit, with dNTPs (250U) (KAPA KK2502, Roche 07958897001)Fisher50-196-5215
SeqAmpâ„¢ DNA Polymerase (200rxns)Takara638509
xGen® Hybridization and Wash Kit, 16 rxnIDT1080577
xGenâ„¢ Universal Blockers TS, 16 rxnIDT1075474
EZ-96 DNA Methylation-Direct MagPrep (Zymo D5044)Fisher50-125-1553
KAPA HiFi HotStart Uracil+ ReadyMix Kit, 6.25ml, 250 rxn (Roche KK2802/07959079001)Fisher50-196-5264
Primer list:
ABCD
Oligo_nameSequenceScalePurification
Bst_RCA_primer_v4GACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T*T250nmPAGE
NEBNext v2 i501AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i502AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i503AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i504AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i505AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i506AATGATACGGCGACCACCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i507AATGATACGGCGACCACCGAGATCTACACCAGGACGTACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i508AATGATACGGCGACCACCGAGATCTACACGTACTGACACACTCTTTCCCTACACGACGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i701CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i702CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i703CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i704CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i705CAAGCAGAAGACGGCATACGAGATTTCTGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i706CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i707CAAGCAGAAGACGGCATACGAGATAGCTTCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i708CAAGCAGAAGACGGCATACGAGATGCGCATTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i709CAAGCAGAAGACGGCATACGAGATCATAGCCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i710CAAGCAGAAGACGGCATACGAGATTTCGCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i711CAAGCAGAAGACGGCATACGAGATGCGCGAGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext v2 i712CAAGCAGAAGACGGCATACGAGATCTATCGCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT*T*A*A250nmPAGE
NEBNext MspI i501-v2AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i502-v2AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i503-v2AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i504-v2AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i505-v2AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i506-v2AATGATACGGCGACCACCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i507-v2AATGATACGGCGACCACCGAGATCTACACCAGGACGTACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i508-v2AATGATACGGCGACCACCGAGATCTACACGTACTGACACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T250nmPAGE
NEBNext MspI i713-v2CAAGCAGAAGACGGCATACGAGATAGGAGGAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i714-v2CAAGCAGAAGACGGCATACGAGATAGCAAGCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i715-v2CAAGCAGAAGACGGCATACGAGATTCATCACCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i716-v2CAAGCAGAAGACGGCATACGAGATCGTAGGTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i717-v2CAAGCAGAAGACGGCATACGAGATTCAGATCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i718-v2CAAGCAGAAGACGGCATACGAGATCGTGATCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i719-v2CAAGCAGAAGACGGCATACGAGATAGTCGCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i720-v2CAAGCAGAAGACGGCATACGAGATGAACGCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i721-v2CAAGCAGAAGACGGCATACGAGATTACGCCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i722-v2CAAGCAGAAGACGGCATACGAGATCTCATCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i723-v2CAAGCAGAAGACGGCATACGAGATTCTTCTGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
NEBNext MspI i724-v2CAAGCAGAAGACGGCATACGAGATGCTGGATTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T*C*A250nmPAGE
P5 PrimerAATGATACGGCGACCACCG*A100nmSTD
P7 PrimerCAAGCAGAAGACGGCATACG*A100nmSTD
SINGLE NUCLEI SORTING AND LYSIS
7h
Schedule FACS with Flow Cytometry Core. Prepare lysis buffer and plates.
Make 10% Triton-X 100 solution --> 9 ml water + 1 ml Triton-X 100.
Make fresh 60fg/ul Unmethylated Lambda DNA solution: Start with the 654 ng/ul stock.
(1) Prepare a 1:100 dilution (e.g., 2ul stock + 198ul Water) to get 6.54 ng/ul.
(2) Prepare a 1:100 dilution of that (e.g., 2ul of 6.54 ng/ul + 198ul Water) to get 65.4 pg/ul.
(3) Prepare a final 1:10 dilution (e.g., 98.85ul of 65.4 pg/ul + 901.15ul Water) to get 6.54 pg/ul or ~60 fg/ul.

Note
This is a control for methylation library to calculate bisulfite conversion rate. Can be optional if you are not doing the methylation part or you want to use other methods to estimate conversion rate. This spike in expected to take ~1-2% of your library space.

Prepare lysis buffer mix. Use Vol 120x for one plate, or as example 550x for five plates . You would need some buffer volume for using multi-pipette with a reservoir.
ABCDEFG
ReagentInitial ConcentrationFinal ConcentrationVol 1xVol 120xVol 550xNote
Tris-EDTA (1 M Tris, 0.1 M EDTA) 20 mM Tris, 2 mM EDTA0.111213.34461.16RT
1 M KCl20 mM0.111213.34461.16RT
10% (vol/vol) Triton X-1000.3% (vol/vol)0.166820.01691.74RT
20 mg/ml protease1 mg/ml0.27833.36152.9Store 4C
Unmethylated Lambda DNA (Promega)60 fg/ul60 fg1.112133.44611.6-20C; Make fresh
Nuclease-free water3.5584427.0081957.12
Total5.3376640.5122935.68
Add 5.34 ul lysis buffer mix per well to 96-well plate with stepper electric pipette. [30ul Thermo Electric pipette - Lysis Buffer]
Note
Here I use a Thermo Fisher electric multi-pipette. First prepare a pooled lysis buffer master mix in a low bind eppendorf tube using the table below. Transfer the mix to a reservoir. Set up the 30ul electric pipette with stepper volume 5.34 ul for faster deposit of reagents.

Sort single nuclei into individual wells of 96-well plate.
Note
If you have multiple samples/tissues, you can sort into divisible 96-well plates. That way you can split the plates and re-assemble multiple divisible plates from different tissues into one 96-well plate for processing. This will minimize batch effect.

Example plate layout:
The first row 20 cell is used as positive control. Last row 0 cell (no sort) as negative control.
Note
You can change your positive control to 100 cells if you want to see a stronger signal in qPCR, Tapestation, this would be like a bulk positive control. If you feel confident, you can reduce the number of control wells to maximize number of cells per experiment.

20 cell20 cell20 cell20 cell20 cell20 cell20 cell20 cell20 cell20 cell20 cell20 cell
1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell
1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell
1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell
1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell
1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell
1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell1 cell
0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)0 cell (NTC)
Immediately after sorting, spin the 96-well plate at 4820G for 5 min at 4C with plate holder, to make sure cells are in the lysis buffer and not sticking to the side.
Note
This is an important step to spin rigorously right after sorting to make sure cell/nuclei are at the bottom of the well. If done properly, usually we see >90% of wells with qPCR signal. Make sure to have a plate holder for 96 well plate that is semi-skirted or not skirted. Spinning at high-speed can deform the plate. I set to 4820G because that is the max speed for our centrifuge, ~5000G should be fine.

Lyse the cell or nuclei at 50C for 3 hr.
Note
I found 3 hr lysis is sufficient for cell line and most tissues. For example, brain tissues are easier to digest than more fibrous tissues like kidney and liver, which will require more time. Under lysis will result in lower yield and less number of targets. Over lysis is usually fine. You might have to test the optimal time for different tissues.

Incubate at 75C for 30 min to inactivate the protease.
Centrifuge at 4820G for 3 min at 4C with plate holder and immediately place on ice.
RESTRICTION ENZYME DIGESTION AND A-TAILING
4h
Prepare dATP, dCTP, dGTP, dTTP mix (for A-tailing)
ABCDE
ReagentInitial ConcentrationFinal ConcentrationVol (ul)Note
dATP (NEB)100mM20mM100 ul-20C
dCTP (NEB)100mM2mM10 ul-20C
dGTP (NEB)100mM2mM10 ul-20C
dTTP (NEB)100mM2mM10 ul-20C
Water370 ul
Total500 ulStore mix -20C for future use
Prepare Restriction Enzyme Master Mix (MseI/MspI + A-tailing)
ABCDEF
ReagentInitial ConcentrationFinal ConcentrationVol 1xVol 120xNote
Tango Buffer10x1x0.965115.8-20C
Klenow exo- (Thermo)5 U/ul4.7 U0.933111.96-20C
MseI (Thermo)10 U/ul4.7 U0.46756.04-20C
MspI (NEB)100 U/ul47 U0.46756.04-20C
dATP, dCTP, dGTP, dTTP mix20mM, 2mM, 2mM, 2mM1mM, 0.1mM, 0.1mM, 0.1mM0.48357.96-20C
Total3.315397.8
Previous step volume6.338This assumes FACS droplet is 1ul
Total + previous vol9.653
Make sure samples are thawed if retrieving from freezer. Spin down plate at 4820G for 3 mins to make sure sample at bottom of well.
Add 3.32 ul Restriction Enzyme Master Mix (12.5ul Electric pipette: RETrace-RE Digestion). Spin at 4820G for 3mins with plate holder.
Note
Ideally, keep all steps at 4C if possible (on ice or cold block). If not, try minimize time sample spent at room temperature.
This step uses the Thermo 12.5ul electric multi-pipette, with pre-defined setting. Generally for all subsequent steps as well, I set speed at 8/10, mix pipette volume >60%, mix ten times.

In a thermocycler, incubate at 37C for 3 hr ---> 80C heat-inactivation for 20 min ---> 10C forever (lid temp: 85C)
ADAPTER LIGATION
1h
Prepare 4uM NEB Methylated Adapter (EM-Seq adapter; #E7140).
For example: 74ul 15uM adapter (original concentration)+ 203.5ul water.
Note
NEB recommend thaw and keep adapter on ice at all times.

Prepare NEBNext Ultra II Ligation Mix
ABCDEF
ReagentInitial ConcentrationFinal Concentration/AmountVol 1xVol 110xNote
Water0.33937.29
NEBNext Ligation EnhancerUnknown stock concentrationRatio: 1ul enhancer in 93.5ul total volume0.17519.25-20C; #E7120
NEBNext Ultra II Ligation Master MixUnknown stock concentrationRatio: 30ul ligation mix in 93.5ul total volume5.276580.36-20C; #E7120
NEB EM-seq adapter4uM0.243uM1110add to premix
Total6.79746.9
Previous step volume9.653
Total + previous vol16.443
Add 6.79 ul NEBNext Ultra II Ligation Mix per well. Spin at 4820G for 3 min. (Thermo 12.5ul Electric multi-pipette)
Note
NEB protocol suggest not to premix and add 1 ul adapter before ligation mix. But I have tested premix and showed it worked fine. This is a lot easier, since pipetting 1ul is difficult using reservoir/electric pipette and require an additional step. Try keep everything on ice to minimize adapter dimer formation.

Incubate at 20C for 15 mins with heat lid off and hold at 4C, according to NEBNext Ultra II ligation protocol.
(Optional) Stop experiment here and freeze in -20C.
SINGLE PRIMER PCR
2h
Prepare Single Primer PCR Master Mix
ABCDEF
ReagentInitial ConcentrationFinal ConcentrationVol 1xVol 107xNote
KAPA High Fidelity Buffer5x1x5535-20C ; KAPA HiFi HotStart PCR Kit
Bst_RCA_Primer_v4Dilute to 10 uM (stock is 100uM)0.3 uM0.7580.25-20C ; 5’ GACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T*T 3’
KAPA dNTP mix10 mM each0.3 mM each0.7580.25-20C; KAPA 10mM dNTP mix from same kit
KAPA HiFi DNA Polymerase1 U/ul0.5 U0.553.5-20C ; KAPA HiFi HotStart PCR Kit, HiFi HotStart tube
Water1.56166.92
Total8.56915.92
Previous step volume16.443
Total + previous vol25.003
Add 8.56ul Single Primer PCR Master Mix per well. Spin at 4820G for 3 mins at 4C with plate holder. (Thermo 30ul Electric multi-pipette)
In a thermocycler: 95C 3 min ---> (98C 20 sec -> 60C 15 sec -> 72C 30 sec) x 20 cycles -> 72C 1 min -> 10C forever.
Separate the resulting product to 5ul and 20ul for downstream microsatellite and methylation processing, respectively.
Note
You can adjust this ratio based on your need. If you don't need to run methylation pipeline, you can use all 25ul for downstream microsatellite pipeline to maximize microsatellite target recovery. We ran an initial single primer PCR amplification in previous step, so this would mitigate the loss of taking only 20% of library for microsatellite processing, but you are welcome to experiment different ratio. The methylation part we took 80% of library, because only the original templates have the methylated adapter (PCR products are not methylated) and thus protected from downstream bisulfite conversion step. But we showed you don't really need a lot of CpGs for cell type inference, so you might have room to do with less.

Transfer 5ul to a new plate Eppendorf LoBind plate for microsatellite PCR. (Thermo 12.5ul Electric multi-pipette)
Note
Make sure to mix well before transfer. Mix at least 8 times. (Thermo 12.5ul Electric multi-pipette)

Spin both plates at 4820G for 3 mins at 4C with plate holder.
Stop here and freeze the two plates at -30C.
METHYLATION PART I: BISULFITE CONVERSION
6h 30m
Protocol is according to Zymo manual but with slight modification to reduce reaction volume and process everything in the same LoBind 96-well plate.
Note
Zymo bisulfite conversion protocol is not designed for single cell (very low input) experiment and not an easy protocol to manually do at the 96 wells format. I tried my best to optimize for single cell, but we still see significant DNA loss likely due to the many washing and transfer steps. Future optimization like scaling to 384-well plate, robotic system, multiplexing multiple cells can potentially improve the DNA yield.

Prepare CT Conversion Reagent
  • Add 7.9 ml of M-Solubilization Buffer and 3 ml of M-Dilution Buffer to a bottle of CT Conversion Reagent.
  • Mix at room temperature with frequent vortexing or shaking for 15 minutes.
  • Add 1.6 ml of M-Reaction Buffer and mix an additional 4 minutes.
Note
  • It is normal to see trace amounts of undissolved reagent in the CT Conversion Reagent.
  • For best results, the CT Conversion Reagent should be used immediately following its preparation. If not used immediately, the CT Conversion Reagent solution can be stored overnight at room temperature, one week at 4°C, or up to one month at -20°C.
  • Stored CT Conversion Reagent solution must be warmed to 37°C then vortexed prior to use.

Prepare M-Wash Buffer:
Add 288 ml of 100% ethanol to the 72 ml M-Wash Buffer concentrate before use.
Take the plate with 20ul product post Single Primer PCR from the previous step (stored at -30C) to room temperature. Make sure it is thawed before processing.
Bisulfite Conversion Step (4 hr - overnight)
Add 65 µl of CT Conversion Reagent to 20 µl of a DNA sample in the same plate. Mix the samples by pipetting up and down. (125ul Thermo Electric pipette). Seal the plate with regular transparent film and try to minimize light exposure (Zymo protocol use Aluminum seal).
Note
All pipette mixing step are generally done for 8-15 times, with mix volume > 60% total volume; if using Thermo electric multi-pipette, set speed to 8-10.

Spin 3 min at 4820G this experiment. Make sure it's balanced.
In a thermocycler run: 98C for 8 min --> 64C for 3 hr --> 4C storage for up to 20 hr (overnight is optional)
4h
Preheat a plate heating element(eg. incubator oven) to 55C.
Bead Purification Step
Prepare master mix: 6600 ul M-Binding Buffer + 110 ul MagBinding Beads. Add 60ul M-Binding Buffer + 1ul beads = 61ul to each well in the same plate.
Note
  • MagBinding Beads settle very quickly, ensure that beads are kept suspended in the reservoir while adding to the plate. Pipette mix frequently or else you could see significant technical variation between rows/columns.
  • Zymo manual use vortexing at 1,300-1,500 rpm for 30 seconds (e.g. Tecan - Te-Shake‱).
  • I don't have the Tecan system, so I use manual hand multi-pipette mix >10 times.
  • Electric multi-pipette in my experience may not be powerful enough to mix beads well.

1h
Let plate stand at room temperature for 5 minutes, then transfer plate to a magnetic stand for an additional 5 minutes or until beads pellet and supernatant is cleared.
With the plate on the magnetic stand remove the supernatant and discard.
Note
  • Set electric pipette speed to 6, too fast can potentially remove beads.
  • Some beads will adhere to the sides of the well. Remove supernatant slowly to allow these beads to be pulled to the magnet as the liquid level is lowered.

Remove plate from the magnetic stand.
Add 120 ul of M-Wash Buffer. Re-suspend the beads by manual multi-pipetting.
Replace the plate on the magnetic stand for 3 minutes. Remove and discard supernatant. (125ul Electric multi-pipette)
Desulphonation Step
Add 100 ul of M-Desulphonation Buffer to the beads. Manual multi-pipette mix >10 times.
1h
Let plate stand at room temperature for 15-20 minutes.
Replace the plate on the magnetic stand for 3 minutes or until beads pellet. Remove and discard supernatant.
Note
Take time for handling/re-suspension into account for the total incubation time. Adjust time as necessary to ensure that no sample remains in the M-Desulphonation Buffer for more than 20-25 minutes.

Add 120 ul of M-Wash Buffer to the beads. Re-suspend the beads by manual multi-pipetting >10 times.
Replace the plate on the magnetic stand for 3 minutes or until beads pellet. Remove and discard supernatant. [125ul Electric multi-pipette]
Repeat this wash step.
Note
Remove as much buffer as possible after final wash to aid in the drying of the beads.

Elute DNA Step
Transfer the plate (without Microseal) to a heating element at 55°C for 15-20 minutes to dry the beads and remove residual M-Wash Buffer.
Note
Beads will change in appearance from glossy black when still wet to a dull brown when fully dry.

30m
Add 26ul or 40ul (for easier dilute) water directly to the dried beads and pipette or vortex for 30 seconds to re-suspend.
Note
This part is not easy since reaction volume is low, it is hard to mix with multi-pipette across 96 well plate. I usually end up pipetting up to ~30 times to visually make sure "most" of the beads are homogenously mixed. However, it's hard to be perfect as these beads are sticky and can adhere to side of the well.

Use microsealer and vortex at 750 rpm for 1 min and quick spin 500G at RT 1 min.
Note
I am not sure if this step adds value, but I do it as additional caution to make sure they mix well and beads are spin down in the mixture.

Heat the elution at 55°C for 4-10 minutes (with microsealer) then transfer the plate to the magnetic stand for 1 minute or until beads pellet.
Remove the supernatant and transfer to a 96-well Eppendorf LoBind plate. [30ul electric multi-pipette]
Note
If beads are removed with the elution, slowly pipetting up and down one or two times will allow them to be pulled to the magnet. If using electric multi-pipette, set fill speed to 5 and dispense speed to 6.

Quick spin at 4820G 4C for 1 min.
The DNA can be stored at -20C or -80C for longer storage.
METHYLATION PART II: METHYLATION PCR
3h
Prepare MspI i5, i7 premix index plate
To make 12.5 uM MspI i5, i7 primer concentration, add the following:
Add 5 ul 100uM i5 primer + 5 ul 100uM i7 primer + 30ul Water = Total 40 ul per well
Note
This is laborious, but only need to be done one time and can be stored at -20C for future experiments. A trick is to use electric multi-pipette (single tip) with multiple steppers for 2.5ul per step. For example, take i501 tube and dispense 2.5ul per step along the row on the left side of the well without needing to change tip. For i713, do it column wise, but dispense on the right side or 6-clock side of the well to avoid contamination.

Example layout:
i501+i713i501+i714i501+i715i501+i716i501+i717i501+i718i501+i719i501+i720i501+i721i501+i722i501+i723i501+i724
i502+i713i502+i714
i503+i713i503+i714
i504+i713
i505+i713
i506+i713
i507+i713
i508+i713

Prepare Methylation Amplification Mix:
ABCDEF
ReagentInitial ConcentrationFinal ConcentrationVol 1xVol 103xNote
KAPA HiFi Uracil+ Master Mix 2x0.84x27.52832.5-20C
Sybr Green100x0.33x0.2222.66
Water0.9698.88
Total28.682954.04
DNA Template vol35
i5,i7 premix indexed primer12.5 uM0.25uM1.32-20C; MspI premix index plate
Total + template vol65
Note
This master mix version adds more DNA template from previous step (26 -> 40ul) for easier dilute, therefore result in diluted reagent concentration. But I have tested this and works fine.

Make sure sample and index primer plate are properly thawed before processing.
Take 35 ul (all volume) post bisulfite conversion as template.
Vortex and spin down premixed MspI index plate.
Add 1.32 ul of MspI premixed index primers, which contains dual-indexed PCR primer specific for MspI-digested microsatellite DNA fragments. (12.5ul Thermo electric pipette)
Add 28.68 ul Methylation Amplification Mix (30ul Thermo electric pipette). Spin at 4820G for 3 min at 4C.
Perform PCR: 95C 3min ---> (98C 20sec -> 60C 15sec -> 72C 30sec) x 32 cycles ---> 72C 1min ---> 10C forever.
Purify PCR product utilizing "AMPure XP bead PCR cleanup" by adding SPRI beads (Beckman Coulter) 0.8x : 1 and perform two 80% ethanol washes.
Note
Doing AMPure per well in 96 well format is tedious even with multi-pipette. A trick here is to pool many wells in a single 1.5ml LoBind tube, and do AMPure on ~10 tubes. I find that easier. You can pool with different strategy, like pool all positive control well together and NTC wells together. For 1-cell well, pool 2 columns (12 wells together, eg. ~730ul + 584ul AMPure beads = 1314 ul total volume). Alternatively, if you have automation system like Kingfisher, you can try that as well.

After adding AMPure beads, pipette mix 10 times.
Incubate RT for 5 mins and place on magnetic rack for 5 mins. Remove supernatant.
Add 700ul 80% ethanol per 1.5mL tube for 1 min, remove supernatant and repeat.
Dry for 3-6 mins. Use P200 pipette to remove any small residue.
Add 200ul water and Incubate for 5 min.
Place on magnetic rack 3 min and transfer to 1.5ml tube.
Run 1 ul for Tapestation and 2 ul for Qubit BR.
Note
Expect Qubit yield ~30-50ng per well and 300-500bp size on Tapestation.

Pool all single cell pool methylation libraries together and store -30C.
The methylation library is ready for sequencing.
MICROSATELLITE PCR
3h
Prepare MseI i5, i7 premix index plate
To make ~4.545uM i5, i7 primer concenration, add the following:
Add 2.5 ul 100uM i5 primer+ 2.5 ul 100uM i7 primer + 50ul Water = Total 55 ul per well
Example layout
i501+i701i501+i702i501+i703i501+i704i501+i705i501+i706i501+i707i501+i708i501+i709i501+i710i501+i711i501+i712
i502+i701i502+i702
i503+i701i503+i702
i504+i701
i505+i701
i506+i701
i507+i701
i508+i701
. his is optional if you want to do qPCR.Prepare Microsatellite Amplification Mix
ABCDEF
ReagentInitial ConcentrationFinal ConcentrationVol 1xVol 103xNote
2X SeqAmp PCR Buffer (includes Mg2+, dNTPs)2x1x12.51287.5-20C
SeqAmp DNA Polymerase--1ul/50ul0.551.5-20C
Sybr Green100x0.4x0.110.3-20C; dilute stock to 100x first. This is optional if you want to do qPCR.
Water5.525569.075
Total18.6251918.375
Transfer template vol 5
i5,i7 premix indexed primer4.545uM0.25uM1.375
Total + template vol25
Make sure sample and index primer plate are properly thawed before processing.
Use the plate with 5ul sample transferred from the Single Primer PCR step.
Add 1.375 ul i5,i7 premix indexed primer, see example layout above (12.5ul Electric pipette)

Note
For premixed index plate, vortex 750 rpm 1 min and quick spin 1 min at 2000G before use.

Add 18.625 ul Microsatellite Amplification Mix (30ul Electric pipette). Spin at 4820 G for 3 min.
Run in a qPCR thermocycler: 94C 1min ---> (98C 10sec -> 60C 15sec -> 68C 30sec) x 6 cycles -> 10C forever
Note
6 cycles should be enough, but if you want a safer margin increase to 7 or 8 cycles.
qPCR is optional to check if you see difference beetween 100-cell, 1-cell, NTC groups. Running on a regular thermocylcer is fine too.

Pool and purify PCR product with "AMPure XP beads (Beckman Coulter) 0.8x : 1 and perform two 80% ethanol washes. See manaul for detail protocol.
Note
Similar to how we did it in the methylation PCR step, consider pooling multiple wells together for AMPure purification. For example, in this step, we can pool 3 columns of 1 cell group (18 wells) into one 1.5ml tube.

Mix beads rigorously by manual hand pipetting >10 times. Electric pipette is not strong enough to mix AMPure beads homogenously.
Incubate RT for 5 mins and place on magnetic rack for 5 mins or until clear.
Remove supernatant and leave around 10ul.
Add 700ul 80% ethanol per 1.5ml tube for 1 min. Remove superntant and repeat.
Dry for 7 mins. Can use 200ul pipette to aspirate remaining ethanol.
Elute PCR amplicons in 35ul water per sample.
Note
Higher volume will increase dry time for hybrid capture step, lower volume is hard to elute due to viscous solution.

Incubate for 3 min and place on magnetic rack for 2 min. Transfer to new tubes.
Run 1-2 ul each for Qubit and Tapestation.
Note
Expect Qubit yield ~10-50ng per well and 300-500bp size on Tapestation.

Mix all tubes and split into tubes of ~500-2000 ng each (can vary based on number of PCR cycles). This is in preparation for the next hybrid capture step. Store at -30C or proceed to hybridization capture.
XGEN HYBRIDIZATION CAPTURE
22h
Modified from IDT official protocol xGen hybridization capture of DNA libraries for NGS target enrichment, v1, some key modification include:
  • increase probe concentration for larger probe (eg. >24k)
  • use of universal blocker
  • switch polymerase from Kapa HiFi to SeqAMP that require addition of Mg++
Pool 500-2000 ng library (from prevous Microsatellite PCR step) per hybrid capture.
Note
IDT technician say max is 6000 ng, but using >2000 ng make the solution very viscous and difficult to work with.

A. Prepare Capture Probe
Prepare capture probes using a T7 RNA polymerase-based production protocol, which detailed at the end of this protocol. You only need to do this once and should generate enough probe for >50 hybrid capture reactions.
B. Combine and dry blocking oligos, Cot-1, and genomic DNA library
Combine the following components into a 1.5ml LoBind tube:
ABC
ItemQuantityNote
Genomic DNA library500-3000 ng
Human Cot-1 DNA (1 mg/mL)5 ulProvided in IDT hybridization kit.
xGEN universal blocker2 ulthis is expensive $71 per reaction, can use water for NTC

Dry the contents of the tube using SpeedVac set at 70C or lower.
Note
At 60C, 80 ul volume takes about 60 minutes to dry down.

(Optional Stopping Point) Seal tube and store at room temperature overnight or -20C for longer.
C. Hybridize DNA capture probes with the library
Thaw all xGEN Lockdown Reagents buffers at RT.
Note
If 2x Hybridization Buffer has crystalized salts, heat tube to 65C and shake.

Prepare the following Probe Reagent Mix for <24k probe set.
ABCD
Vol 1xVol 2x (uL)Note
xGEN 2X Hyb Buffer8.517
xGEN Hyb Buffer Enhancer2.75.4
Nuclease-Free Water1.83.6
xGEN Lockdown Probe (1.5pmol/2uL)481.5pmol/2uL or 37.96 ng/ul for new probe design (120nt target + 43nt primer + biotin = 50,624 g/mol)
Total17
For >24k probe, prepare with this Probe Reagent Mix that has higher probe concentration.

ABCDE
Vol 1x (uL)Vol 2x (uL)Vol 3x (uL)Note
xGEN 2X Hyb Buffer8.51725.5
xGEN Hyb Buffer Enhancer2.75.48.1
xGEN Lockdown Probe 6x (9.08pmol/2uL)5.811.617.4Aim for 6-9x of standard protocol
Total17
Note
Larger probe require higher concentration to get enough yield, use high concentration protocol and adjust accordingly. Probe concentration can vary from different production experiments, it is easier to aliquot in lower volume to have higher concentration, then dilute as needed.

Add the Probe Reagent Mix 17ul to the tube from Step B, pipette mix, brief spin and incubate at RT 5-10 min.
Pipette up and down to mix, and transfer to a LoBind strip PCR tube.
Incubate in a thermal cycler (heated lid at 100C): 95C 30sec --> 65C 4-18hr (hold at 65C after 4hrs until ready for wash).
Note
Consider overnight incubation if not time-constrained. Previous 18hr incubation experiment showed 10% higher on-target %.

D. Prepare Wash Buffer
For a single capture reaction, dilute the following xGEN buffers (adjust volume for multiple reactions).
ABCD
Concentrated Buffer, Vol 1x (uL)Nuclease-free water, Vol 1x (uL)Note
xGEN 2x Bead Wash Buff150150
xGEN 10x Wash Buff I25225If cloudy heat at 65C to resuspend particulates
xGEN 10x Wash Buff II15135
xGEN 10x Wash Buff III15135
xGEN 10x Stringent Wash Buff30270
Prepare aliquots of Wash Buff I and Stringent Wash Buff from Table4, and store at the following temperature:
ABCD
Volume of 1x Buffer (uL)Temperature for 1x BufferNote
xGEN 10x Wash Buff I10065CPreheat buffers at 65C for at least 1-2hrs before use in Step G
xGEN 10x Wash Buff I150RT
xGEN 10x Stringent Wash Buff150 *265CPreheat buffers at 65C for at least 1-2hrs before use in Step G
Preheat buffers at 65C for at least 1-2hrs before use in Step G. Keep the remaining 1x buffers at RT.
In LoBind tube, make the following Bead Resuspension Mix:
ABCD
Vol 1x (uL)Vol 2xVol 3x
xGEN 2x Hyb Buff 8.51725.5
xGEN Hyb Buff Enhancer 2.75.48.1
Nuclease-Free Water 5.811.617.4
Total17
Can stop here and wait until 45mins before step C hybridization is done.
E. Prepare the streptavidin beads
Equilibrate Dynabeads M-270 Streptavidin beads at RT 30min before use.
Mix beads by vortexing for 15sec.
Aliquot 50ul beads + 100ul 1x Bead Wash Buff per capture into 0.2ml low-bind tube (or 1.7ml tube for more captures). Pipette mix 10x.
Place tube in magnetic rack ~1min. Discard supernatant. Remove from magnet.
Perform the following wash:
  • Add 100ul of 1x Bead Wash Buff per capture; pipet the mix 10x.
  • Place tube in magnetic rack.
  • Remove and discard supernatant.
Repeat previous wash step.
Add 17ul of Bead Resuspension Mix per capture and vortex.
F. Bind hybridized target to the streptavidin beads
Transfer the 17ul homogenized beads per reaction to samples (from Step E).

Mix by pipetting up and down 10x (or vortex + brief centrifuge).
Bind DNA to the beads by placing tube in thermal cycler at 65C (with heated lid at 70C) for 45min.
Every 12min during incubation, vortex tubes for 3sec to ensure beads remain in suspension (Tip: easier to vortex on plate holder).
G. Wash streptavidin beads to remove unbound DNA (use 1x wash buffs from Step D)

Perform 65C washes
  • Add 100ul preheated 1x Wash Buff I to tube from Step F.
  • Pipet mix 10x (careful not to introduce bubbles).
  • Place tube in magnetic rack 1min. Discard supernatant. Remove from magnet.

Perform the following wash:
  • Add 150ul preheated 1x Stringent Wash Buff, and pipette mix 10x.
  • Incubate at 65C 5min.
  • Place tube in magnetic rack. Discard supernatant. Remove from magnet.
  • Repeat previous wash step.
Perform RT washes
  • Add 150ul RT 1x Wash Buff I and vortex for 2min in 30sec intervals (30sec vortex -> 30sec rest -> 30sec vortex -> 30sec rest).
  • Brief centrifuge. Place tube in magnetic rack 1min. Discard supernatant.
  • Add 150ul RT 1x Wash Buff II and vortex for 2min in 30sec intervals.
  • Brief centrifuge. Place tube in magnetic rack 1min. Discard supernatant.
  • Add 150ul RT 1x Wash Buff III and vortex for 2min in 30sec intervals.
  • Brief centrifuge. Place tube in magnetic rack 1min. Discard supernatant.
Resuspend beads
  • Remove tube containing beads with captured DNA from the magnetic rack.
  • Add 40ul Nuclease-Free Water to beads.
  • Pipet up and down 10x and ensure any beads stuck to the side of the tube have been resuspended.
H. Perform final, postcapture PCR enrichment
Prepare the following Post Capture PCR mix.

ABCDE
Vol 1x (uL)Vol 2x (uL)Vol 3x (uL)Note
2X SeqAmp PCR Buffer50100150
SeqAmp DNA Polymerase246
MgCl2 (25mM; Kapa HiFi kit)61218This reagent is part of KK2501 kit.
P5 primer (25uM)123Dilute 1:4 of stock 100uM
P7 primer (25uM)123Dilute 1:4 of stock 100uM
60120180
Beads40
Total60 + 40 beads
Note
IMPORTANT: SeqAMP requires higher Mg2+ concentration for on-bead PCR, and double anneal & ext time. Using standard protocol will get a very low yield. SeqAMP (Mg2+ conc 2.5mM, original 1mM + additional 1.5mM). We switched to SeqAMP from Kapa Hifi due to higher fidelity for amplifying microsatellite sequence. See detail in RETrace2 manuscript.

Add 60ul Post Capture PCR Mix to 40ul bead mixture.
Thermocycler (SeqAMP protocol for on-bead PCR): 94C 1min -> (98C 10sec -> 60C 30sec -> 68C 30sec)x 5-8 cycles -> 10C forever.
Note
Number of PCR cycle depends on what sequencing platform you are using. 5 cycle is the minimum for running on Element Bio AVITI sequencer, which only requires 3 ng library. Run more cycles to be safe or if using other platforms. For example, 8 cycles should get you >50 ng.

(Optional Stopping Point) Amplified captures may be stored at 4C overnight.
I. Purify postcapture PCR fragments
Important! Ensure Agencourt AMPure XP beads have been equilibrated to room temperature before proceeding.

Add 120ul (1.2x volume) AMPure XP beads to each PCR-enriched capture.
  • Pipette mix >10 times. Incubate for 5 min and place on magnetic rack for 5 min or when clear.
  • Remove supernatant. Leave 5ul.
  • Wash with 180ul 80% ethanol for 1 min, twice.
  • Make sure remove all ethanol. Dry bead for 3 min.
Elute in 20-40 ul water. Incubate for 2 min and place on magnetic rack for 1 min.
Run 1-2 ul for Qubit and Tapestation.
Note
Run 2ul Qubit HS for better accuracy, need for pooling.

Store single cell pool microsatellite post hybrid capture library at -30C.
SEQUENCING LIBRARY POOL SUBMISSION
Pool microsatellite library and methylation library by 90% and 10%, respectively. This is to aim 9M reads for microsatellite and 1 M reads for methylation per cell.
Note
For some reason, aiming for 85% microsatellite vs 15 % methylation library, based on my experience, get me closest to 9M and 1 M reads per cell for Microsatellite and Methylation library, respectively.

Example pooling table:
ABCDEFGHI
SampleQubit dsDNA (ng/uL)Library Size (bp)Concentration (nM)Dilution Factor (1= no diltue, 10 = 1ul sample + 9ul water)Pool FractionTarget Concentratioin (nM)Vol (uL) to add after diluteNote
Post hybrid caputre library (Microsatellite)3.9744013.6710.85610.07Element Bio require at least 20ul at 1nM
Methylation Library [NEED DILUTE!]6.9139726.37100.1569.21Dilute if pipette volume <2ul for better accuracy
Water7.71
Total (target aim)27
RETrace2_Combined_Library1.23433.554.2925Check Qubit 2ul again for final sample submission
Combined library is ready for sequencing.
Run configuration: Read 1: 250 bp, Index 1: 8 bp, Index 2: 8 bp.
RETRACE2 PROBE PRODUCTION
This protocol is used to produce RETrace v2 probe from oligo pools that is compatible with IDT xGEN hybridization and wash kit.
Schematic workflow:

5' | TGTAAGGACACATCTCGGATC |-----Target-----| ATCCGACGAGAACTCTTGCTT | CCCTATAGTGAGTCGTATTA 3' 5' TGTAAGGACACATCTCGGATC> 3' (20bp, Tm=54.3C) 3' <CGAAGGGATATCACTCAGCATAAAT 5' (24bp, Tm=54.4C) | V A few cycle of PCR to create dsDNA template for transcription V 5' | TGTAAGGACACATCTCGGATC |-----Target-----| ATCCGACGAGAACTCTTGCTT | CCCTATAGTGAGTCGTATTA 3' 3' | ACATTCCTGTGTAGAGCCTAG |-----Target'----| TAGGCTGCTCTTGAGAACGAA | GGGATATCACTCAGCATAAAT 5' <---- | V T7 polymerase to produce RNA probes V 5' GGG | AAGCAAGAGUUCUCGUCGGAU | --RNA(Target')-- | GAUCCGAGACAUGUCCUUACA | 3' | V MMLV RT with specific primers V 5' GGG | AAGCAAGAGUUCUCGUCGGAU | --RNA(Target')-- | GAUCCGAGACAUGUCCUUACA | 3' <CTAGGCTCTACAGGAATGT/5Biosg/ | V Digest with RNase H to remove unwanted RNA template after RT V 5' /5Biosg/T*G*TAAGGACACATCTCGGATC | --DNA(Target)-- | ATCCGACGAGAACTCTTGCTT | CCC 3' (final probe)
Materials
ABC
Item DescriptionVendorCatalog #
Oligo poolTwist Bioscience
Kapa Hifi Hotstart ReadyMix, 1.25ml, 50 x 50 uL reactions (Roche KK2601/07958927001)Fisher50-196-5217
T7 RNA Polymerase, 50,000 units/ml, 25,000 units (NEB M0251L)NEBM0251L
Ribonucleotide Solution Set, 10 µmol (NEB N0450S)NEBN0450S
RNase Inhibitor, 10,000 U @ 40 U/LEliminate RNase activity (Lucigen 30281-1)FisherNC1819281
Maxima H Minus Reverse Transcriptase, 200 U/µL (Thermo Fisher EP0752)FisherFEREP0752
RNase H, 5,000 units/ml, 250 units (NEB M0297S)NEBM0297S
DNA Clean & Concentrator-5, 50 preps (Zymo D4013)FisherNC9122861
ssDNA/RNA Clean & Concentrator, 50 preps (Zymo D7011)Fisher50-444-498
Primers:
T7_prodPCR_1TAATACGACTCACTATAGGGAAGC25nmSTD
T7_prodPCR_2/5Phos/TGTAAGGCACATCTCGGATC25nmSTD
T7_RT_primer/5Biosg/T*G*TAAGGCACATCTCGGATC100nmSTD

EXPANSION PCR
  • Tube of dry oligo pool produced by Twist Bioscience is ~100 to 200 ng per 12k oligo pool.
  • Spin down and resuspend in TE buffer, wait several minutes before measure Qubit (ssDNA) --> aim for 2 ng/ul or more for larger oligo pool.
Example of expansion PCR Mix (used in mouse 169k probe set):
ABCDEFG
Initial ConcentrationFinal ConcentrationVol 1x (uL)Vol 2x (uL)Vol 8x (uL)Note
Oligo pool8.6 ng/ul30ng3.496.9827.92Use more DNA input with larger pool
KAPA HiFi MM2x1x2550200
T7_prodPCR_1100uM --> dilute 1:5 to 20uM400nM128
T7_prodPCR_2100uM --> dilute 1:5 to 20uM400nM128
Water19.5139.02156.08
Total vol50400
(Optional) Sybr Green100x0.4x0.21.6for testing
Note
Limit reaction volume to max 50ul for better temperature regulation.
Make more reactions (eg. >8x) for large probe which require higher concentration.

(Optional) Test run qPCR (eg. 15 cycles) first to check what is the minimum number of PCR cycles to use while not using too much oligo pool mass.
Note
Spike in 100x SYBR green 0.2ul per 50ul reaction.
The idea is we want to use less PCR cycles to minimize potential PCR bias that would cause non-uniform probe set. At the same time, we need enough cycles to have good enough probe yield and not use up all of our oligo pool mass.

Thermocycler: 95C 3min -> (98C 20sec -> 60C 15sec -> 72C 15sec) x10 -> 72C 1min -> 10C forever
Purify 1st round amplicon with Zymo DNA Clean & Concentrator-5 kit -> Elute in 20ul water per Zymo tube and pool.
Dilute purified amplicon to 200nM (Probe 180bp dsDNA 22.25ng/ul).
Note
If concentration lower than 200nM, dilute to 100nM and adjust template volume.
Based on experience, the concentration after expansion PCR should be pretty close to this, usually no need for dilution.

T7 RNA IN VITRO TRANSCRIPTION
Example of T7 RNA in vitro Transcription Mix
ABCDE
Initial ConcentrationFinal ConcentrationVol 1x (uL)Vol 134x (uL)
Water----14.11889.4
RNA Polymerase Buffer10x1x2268
UTP100mM0.5mM0.113.4
GTP100mM0.5mM0.113.4
ATP100mM0.5mM0.113.4
CTP100mM0.5mM0.113.4
T7 RNA Polymerase50U/ul5U/ul2268
NxGEN RNAse Inhibitor40U/ul1U/ul0.567
Total192546
Expansion PCR Template or NTC200nM10nM1134
Total + Template vol202680
Run 20 or 40ul reaction volume per tube.
Thermocycler: 37C overnight (~18hr) --> 4C forever.
Purify using Zymo ssDNA/RNA Clean and Concentrator (combine 8rxn/160ul per tube, max volume limit).
Elute in 11ul water and combine into single tube.
REVERSE TRANSCRIPTION AND RNASE H DIGESTION
Run Reverse Transcription(RT) using Thermo Maxima H Minus according to manual.
Make single master mix by combining all Zymo purified tubes in previous step then split into individual PCR tubes.
Prepare Reverse Transcription Mix
ABCDEF
Initial ConcentrationFinal ConcentrationVol 1x (uL)Vol 4x (uL)Vol 14x (uL)
T7_RT_Primer100uM1uM0.20.82.8
dNTP Mix10mM0.5mM1414
Water----3.815.253.2
RT Buffer5x1x41656
Thermo Maxima H Minus200U/ul10U1414
Total1040140
RNA Template----10140
Total + Template vol20280
Thermocycler: 50C 30 min -> 85C 5 min -> 10C forever.
Proceed directly to RNase H digestion (to remove original RNA template).
Make single master mix using combination of all RT reactionns above then split into individual PCR tubes.
Prepare RNase H Mix
ABCDEF
Initial ConcentrationFinal ConcentrationVol 1x (uL)Vol 4x (uL)Vol 16x (uL)
RNase H Buffer10x1x52080
RNase H5U/ul5U1416
Water----2496384
Total30120480
RT template----20
Total + template50200
Thermocycler: 37C 1hr -> 10C forever.
Zymo ssDNA/RNA Clean and Concentrator. Can pool into <160ul per reaction.
Elute in 20ul per reaction and pool.
Probe Dilution
  • You should get around ~50,000 to 70,000ng in 20ul.
  • Keep the original high concentration tube for large (>24k) probe, aim for 24pmol/2ul.
  • Dilute probe to 1.5pmol/2ul (37.96ng/ul; 120nt target + 43nt primer + biotin = 50,624 g/mol) for standard IDT protocol.
  • Aim for 8x standard probe concentration for 169k mouse probe --> Dilute to 12pmol/2uL = 303.68 ng/ul

Note
Do gradual serial dilutions to check Qubit ssDNA (2ul). Careful! Qubit measurements vary and it's easy to over-dilute.


Run 2ul TBU gel (220V for ~20 to 40mins) or RNA Tapestation to check probe size.

Expected result
Expect ~180nt band on Tapestation.