Feb 18, 2026
Real-time RT-PCR for detection of Yellow Dwarf Viruses
- Stephen Byrne1,
- Jack Perry1,
- Louise McNamara1,
- Md Munir Mostafiz1
- 1Teagasc, Crops Research, Oak Park, Carlow R93XE12
Protocol Citation: Stephen Byrne, Jack Perry, Louise McNamara, Md Munir Mostafiz 2026. Real-time RT-PCR for detection of Yellow Dwarf Viruses. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpmm1jgzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 26, 2025
Last Modified: February 18, 2026
Protocol Integer ID: 230813
Keywords: yellow dwarf virus, BYDV, RT-PCR, aphid, barley, surveillance of key yellow dwarf virus, key yellow dwarf virus, pcr for detection, nucleotide, serial dilutions of gene fragment, yellow dwarf, single nucleotide polymorphism, gene fragment, aphid, aphid internal control, following species, pcr, barley sample matrix, species, high throughput assay, temperature of the shorter probe
Funders Acknowledgements:
Marie Skłodowska-Curie Actions (MSCA)
Grant ID: 101106698
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
The purpose was to create a useful assay to identify and distinguish BYDV-PAV, BYDV-MAV, and BYDV-PAS in a single reaction together with an internal control (for both an aphid and a barley sample matrix). The goal was to have a high throughput assay that could be used in the surveillance of key yellow dwarf viruses. Given the challenge in distinguishing all three species in one reaction, this required the design of shorter probes to distinguish between two of the species that were only two nucleotides apart in the target region. This required the use of locked-nucleotides to increase the annealing temperature of the shorter probes. These were designed to flank each of the two single nucleotide polymorphisms. The linearity and specificity of each target was confirmed using serial dilutions of gene fragments. The aphid internal control has been tested on the following species and shown to function: Rhopalosiphum padi, Sitobion avenae, Metopolophium dirhodum.
Materials
>IRE-24601-MAV-gbloc
TCAAAACCGGTCTCTATTAATGGGAGGTACAGAATGGTTAGAAGGCCCGATAGCATAGGCAAAGACAGCACAACACTACT
GAGCATGCTCAACCAATCCGACGTCAAAAGTTACATGTCGGCTGTGGCTCAGTGTGGTTTGGTGCTCAACGCTGGAGTAC
CCATACTTGAAAGCTTCTATAAATGCCTATATAGAAGTTCAGGGTACAAGAAAGTGAGTGAGGAATTCATCAAAAACGTC
ATTTCGTATGGAACAGATGAGAGACTACAAGGTAGACGTACCTTCSAAGACACACCTATC
>IRE-24601-PAS-gbloc
TCAAAACCCGTCAGAATAGATGGCAAATACAGAATGGTGAGGAGACCAGACTGTATTGGAAAAGACAGCTGCACACTTTT
GAGCATGTTGAATGAGGCTGACGTYAAGAGTTACATGTCAGCTGTGGCTCAGTGTGGACTCGTTTTGAATGCGGGTGTGC
CCATTTTGGAAAGCTTCTACCGCTGCCTGTACAGAAGCTCTGGGTACAAGAAAGTGAGTGAGGAATACATCAAAAACGTC
ATATCATATGGAACAGATGAACGCCTTCAAGGTAGACGTACCTTCAAGGAGACACCTATC
>IRE-24601-PAV-gbloc
TCAAAACCGGTCTCTATTAATGGAAAGTATAGAATGGTCAGAAGGCCCGATAGCATAGGCAAAGACAGCACAACACTATT
GAGCATGCTCAATCAATCCGACGTCAAGAGTTACATGTCGGCTGTTGCTCAGTGTGGCTTGGTGCTTAACGCTGGAGTAC
CCATACTTGAAAGTTTCTATAAATGCCTGTATAGAAGCTCGGGGTACAAGAAAGTGAGTGAGGAATTTATTAAAAACGTC
ATATCGTATGGAACAGATGAGAGACTTCAAGGTAGACGTACCTATAACGAAACACCTATC
Troubleshooting
Safety warnings
Please read SDS associated with various consumables and kits used in this protocol and wear appropriate PPE. A site specific procedural risk assessment should be carried out prior to introducing this protocol to the lab.
Primer and Probe Design
The primer and probes for YDV were designed using genomes assembled from HTS of symptomatic barley samples in Ireland (Byrne et al., 2024). The primers are designed to target a region of 120 bp in ORF3-5 and were ordered from IDT as follows:
| Primer name | Sequence | |
| IRE-24601-for | ARA GTT ACA TGT CRG CTG TKG C | |
| IRE-24601-rev | TCC TCA CTC ACT TTC TTG TAC CC | |
| IRE-24601-HV-for | GGT GAG AAG GAG GTT GCT GTG | |
| IRE-24601-HV-rev | TGA AAA CAC CGG TGG ACT CCA | |
| IRE-24601-SA-for | GCG AAG TTT CTG TTG ATG GAG AC | |
| IRE-24601-SA-rev | GCA CCA GCA GAT CCC CAT TGG |
Primers for the IRE-24601 assay. This includes primers to target a region in ORF3-5 of the BYDV genome, and primers to target GAPDH in barley and aphids.
The 5′ nuclease probes for each of the three species Luteovirus pavhordei, Luteovirus mavhordei, and Luteovirus pashordei were ordered from IDT as described in the table below.
| Probe Name | Sequence (with modifications) | Reporter Dye | Modifications | |
| IRE-24601-PAS-P | /5TexRd-XN/TGT GGA CTC GTT TTG AAT GCG GGT GTG C/3IAbRQSp/ | Texas red | 5' Texas Red®-X (NHS Ester) 3' Iowa Black™ RQ-Sp | |
| IRE-24601-MAV-APP | /5HEX/TG+G +T+TT GGT GC+T +C+AA C/3IABkFQ/ | Hex | Affinity Plus™ 5' HEX 3' Iowa Black™ FQ | |
| IRE-24601-PAV-APP | /5Cy5/TG+G +C+TT GGT GC+T +T+AA C/3IAbRQSp/ | Cy5 | Affinity Plus™ 5' Cy®5 3' Iowa Black™ RQ-Sp | |
| IRE-24601-HV-P | /56-FAM/AGA TTC CAT /ZEN/GGG CCG CTG CTG GT/3IABkFQ/ | Fam | Int ZEN™ 5' 6-FAM 3' Iowa Black™ FQ | |
| IRE-24601-SA-P | /56-FAM/TTC TCT GAA /ZEN/CGC GAC CCA AAG GCC A/3IABkFQ/ | Fam | Int ZEN™ 5' 6-FAM 3' Iowa Black™ FQ |
Probes for the IRE-24601 assay. + indicates locked nucleotides in the probes with suffix 'APP' (Affinity Plus from IDT); these surround the two nucleotides distinguishing Luteovirus pavhordei and Luteovirus mavhordei
Please note that during development , it was demonstrated that longer probes designed without locked nucleotides fail to distinguish between Luteovirus pavhordei, and Luteovirus mavhordei. The shorter Affintiy Plus probes are required.
The primers and probes were all prepared as stocks of 100 micromolar (µM) and two working primer mixes and two working probe mixes were prepared as follows:
| Mix Name | Sample Matrix | Components | |
| IRE-24601-hvITC-primers | barley | IRE-24601-for; IRE-24601-rev; IRE-24601-HV-for; IRE-24601-HV-rev (each at 10 uM) | |
| IRE-24601-saITC-primers | aphids | IRE-24601-for; IRE-24601-rev; IRE-24601-SA-for; IRE-24601-SA-rev (each at 10 uM) | |
| IRE-24601-hvITC-AAPs | barley | IRE-24601-PAS-P; IRE-24601-PAV-APP; IRE-24601-MAV-APP; IRE-24601-HV-P (each at 10 uM) | |
| IRE-24601-saITC-AAPs | aphids | IRE-24601-PAS-P; IRE-24601-PAV-APP; IRE-24601-MAV-APP; IRE-24601-SA-P (each at 10 uM) |
Primer and probe mixes prepared for use in the assay. The combination of primer/probe mixes will depend on the sample matrix - this ensures the correct internal control is utilised.
Gene Fragments
Gene fragments were synthesised (IDT gBlocks) for use as control material and to test specificity of probes during initial testing and design phase. A 300 bp fragment covering the target region was synthesised for all three species. The sequence of all three is included under the protocols materials section.
The gene fragments were prepared as 10 ng/ul stocks and then serially diluted for use in testing linearity and efficiency of each target, testing specificity, and for making positive control mixes.
A positive control mix was created for routine use when testing plates of samples - for use in addition to real positive (aphid or barley positive for virus) and negative (aphid or virus free barley). The gBlock control mixes were prepared by mixing together the three gBlocks for each species (at 0.1 ng/ul of each gBlock).
Real-Time RT-PCR
The assay was developed and run on an LC96 (Roche) (although should work on other systems compatible with dyes used here). The assay was optimised using PrimeTime‱ One-Step RT-qPCR Master Mix from Integrated DNA Technologies.
The reactions were set-up on ice according to the following recipe (this is for the case of testing a barley sample matrix):
| Component | Amount (ul) | |
| PrimeTime One-Step RT- qPCR Master Mix (2X) | 10 | |
| IRE-24601-hvITC-primers (10 uM) | 1 | |
| IRE-24601-hvITC-AAPs (10 uM) | 0.5 | |
| Molecular Grade Water | 6.5 | |
| Total | 18 |
RT-PCR reaction recipe - the final reaction volume will be 20 ul after addition of 2 ul of template RNA.
The reactions were prepared in white opaque plates and sealed with optically clear film. The master mix was prepared and dispensed into each well prior to addition of 2 µL of template RNA. All reactions were prepared on ice and the plate was briefly spun down before loading into the LC96.
The cycling parameters are:
- 50 °C for 00:15:00
- 95 °C for 00:03:00
- 95 °C for 00:00:15
- 60 °C for 00:01:00
Steps 3-4 are repeated for 40-45 cycles.
Analysis
The results are analysed with the LightCycler 96 software as a qualitative analysis. The internal control is identified in the analysis and used as control to validate extraction, and reaction. Samples negative for internal control are disregarded if virus negative.
A Cq cut-off of 30 cycles was implemented and minimum endpoint fluorescence threshold (EPF) was identified and selected for each target.
Protocol references
S. Byrne, M. Schughart and V. Ballandras et al. The first survey using high-throughput sequencing of cereal and barley yellow dwarf viruses in Irish spring and winter barley crops. Irish Journal of Agricultural and Food Research. 2024. Vol. 63(1):1-16. DOI: 10.15212/ijafr-2023-0110