Icon indicating open access to content
QR code linking to this content
Protocol CitationShiyi Wang 2024. Real-time qPCR. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlk8mexl5r/v1
Manuscript citation:
Salazar MPR, Kolanukuduru S, Ramirez V, Lyu B, Manigault G, Sejourne G, Sesaki H, Yu G, Eroglu C (2025) Mitochondrial fission controls astrocyte morphogenesis and organization in the cortex. The Journal of Cell Biology 224(10). doi: 10.1083/jcb.202410130
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 10, 2024
Last Modified: July 10, 2024
Protocol  Integer ID: 103173
Keywords: ASAPCRN, time qpcr
Funders Acknowledgements:
Aligning Science Across Parkinson’s (ASAP) initiative
Grant ID: ASAP-020607
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Real-time qPCR
**Prepare cDNA Samples** - Plate cDNA samples on a 96-well qPCR plate.
**Prepare Reaction Mix** - Combine the following in each well: - 5 μL Fast SYBR Green Master Mix (4385616, Applied Biosystems) - 3 μL nuclease-free water - 0.5 μL forward primer - 0.5 μL reverse primer - 1 μL cDNA sample
**Ensure Technical Replicates** - Plate each sample two to four times to ensure technical replicates.
**Prepare Negative Control** - Use a control sample consisting of water with primers and Master Mix as a negative control.
**Perform qPCR** - Collect cycle threshold (Ct) values for each well.
**Normalize Data** - Normalize Ct values to GAPDH as a housekeeping gene.
**Primer Sequences** - Forward (F) primer for Atg7: 5′- GTTCGCCCCCTTTAATAGTGC -3′ - Reverse (R) primer for Atg7: 5′- TGAACTCCAACGTCAAGCGG -3′