May 09, 2023

Rapid Ribosome (Polysome) Profiling

Rapid Ribosome (Polysome) Profiling
  • 1University of California, San Francisco;
  • 2Stanford University, Stanford
Icon indicating open access to content
QR code linking to this content
Protocol CitationJason D Limberis, Yuxiang Chen 2023. Rapid Ribosome (Polysome) Profiling. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7ykmqgwz/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
While we have not tested this protocol, it is theoretically sound.
Created: April 11, 2023
Last Modified: May 09, 2023
Protocol  Integer ID: 80279
Keywords: profiling ribosome profiling, traditional ribosome profiling method, rapid ribosome, ribosome, positions of ribosome, mrna fragment, protected mrna fragment, translation rate, translated open reading frame, genome, transcript, translation, sequencing, open reading frame
Abstract
Ribosome profiling is a powerful technique used to study translation at a genome-wide level. It involves the sequencing of ribosome-protected mRNA fragments to determine the positions of ribosomes on transcripts. This information can be used to infer translation rates and identify translated open reading frames. While traditional ribosome profiling methods can be time-consuming and expensive, our method is rapid and cost-effective, and the inclusion of UMIs allows for precise quantification.
Attachments
Materials
AB
NameSequence
RiboS_linkerrCAAGCAGAAGACGGCATACGAGAT
RiboS_linker_primerATCTCGTATGCCGTCTTCTGCTTG
RiboS_IlluminaAdapt_TSO_UMI_RNA_FACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNGATrGrGrG
RiboS_blocking_oligoCTACCCCAAGCAG
Index 1 ReadGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG
Index 2 ReadAATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Oligonucleotides. "r" indicated RNA base.
Monarch RNA Cleanup Kit (10 µg) - 100 prepsNew England BiolabsCatalog #T2030L
Agencourt RNAClean XP Magnetic BeadsBeckman CoulterCatalog #A63987
RtcB Ligase - 25 rxnsNew England BiolabsCatalog #M0458S Superase-In RNase InhibitorThermofisherCatalog #AM2694
Template Switching RT Enzyme Mix – 100 rxnsNew England BiolabsCatalog #M0466L

Optional
Urea page
TBE
Agarose
Before start
Read through the protocol and ensure you have the correct reagents depending on your chosen approach
RNA isolation and nuclease footprinting
Perform RNA isolation and nuclease footprinting as appropriate for your cell type
(see steps 1-17 here for cultured mammalian cells)
Optional but recommended preselection of small RNA fragments using either a urea PAGE gel or bead and membrane selection.
Step case

15% UREA-TEB PAGE
45 steps

Recipe for casting own gel:
Urea 19.2g
40% Acrylamide/Bis (19:1) 15ml
10X TBE 4ml
25% APS 200ul
TEMED 20ul
Adding nuclease free water to 40ml
Add the appropriate volume of 2X RNA loading buffer to each RNA sample
Denature the samples for 80 °C 00:01:00 followed by ≥00:02:00 on On ice
3m
Load the samples on the polyacrylamide gel with TBE running buffer
Pre-run the gel in 1X TBE buffer at 100V for 10min
Optional: preselection of small RNA fragments
5m
Separate by electrophoresis for 01:30:00 at 100V
1h 30m
Stain the gel for 00:03:00 with 1X SYBR Gold in 1X TBE running buffer on a shaker
3m
Visualize the gel and excise desired region (20-40nts)
Transfer the excised gel slice to a 1.5 mL microcentrifuge tube and weigh it.
Pro Tip: Smashing the gel in the tube increases RNA recovery.
Add 4 volumes of Monarch RNA Cleanup Binding Buffer to the tube with the slice
Incubate the sample between 55 °C , gently mixing periodically until the gel slice is completely dissolved (generally <00:10:00 )

10m
Add two volumes of absolute ethanol to the sample and mix well by pipetting up and down
Incubate the sample between 55 °C or an additional 00:05:00

5m
Insert an RNA cleanup column into a collection tube, load the sample onto the column and close the cap
Spin for 00:01:00 , then discard flow-through
1m
Re-insert the column into the collection tube
Add 500 µL RNA Cleanup Wash Buffer

Spin for 00:01:00 , then discard flow-through
1m
15 for a total of two washes.

Transfer the column to a clean 1.5 ml microfuge tube
Add 10 µL nucleae-free water directly to the membrane and incubate at Room temperature for 00:05:00

5m
Spin for 00:01:00
1m
Overview


Linker ligation
Add 1 µL of 100 micromolar (µM) RiboS_linker (linker RNA oligo) to 10 µL of RNA, denature it for00:01:00 at 70 °C , and then cool it to Room temperature
1m
Set up the ligation reaction below and incubate for 01:30:00 at 37 °C
AB
ComponentVolume (μl)
RNA and linker11
RtcB Reaction Buffer (10X)2
SUPERase·In (20 U/μl)1
1 mM GTP2
10 mM MnCl22
RtcB RNA Ligase1.5
H200

1h 30m
RNA cleanup
Add 100 µL RNA Cleanup Binding Buffer

Add 150 µL absolute ethanol and mix by pipetting

Insert an RNA cleanup column into a collection tube, load the sample onto the column and close the cap
Spin for 00:01:00 , then discard flow-through
Re-insert the column into the collection tube
Add 500 µL RNA Cleanup Wash Buffer

Spin for 00:01:00 , then discard flow-through
6 for a total of two washes.

Transfer the column to a clean 1.5 ml microfuge tube
Add 10 µL nucleae-free water directly to the membrane and incubate at Room temperature for 00:05:00

Spin for 00:01:00
RT (TSO) reaction
2h 37m 30s

AB
ComponentVolume (μl)
RNA9
RiboS_linker_primer (100uM; reverse transcription primer)2
dNTP mix (10 mM each)2
Mix thoroughly by gently pipetting up and down at least 10 times, then centrifuge briefly to collect the solution to the bottom of the tube
Denature for00:05:00 at 70 °C in a thermal cycler and then place on ice for ≥00:01:00
6m
Vortex the Template Switching RT Buffer briefly followed by a quick spin
Combine the following components in a reaction tube
AB
ComponentVolume (μl)
Template Switching RT Buffer5
RiboS_IlluminaAdapt_TSO_UMI_RNA_F (75uM)1
Template Switching RT Enzyme Mix1
RT reaction mix
Mix thoroughly by gently pipetting up and down at least 10 times, then centrifuge briefly to collect the solution to the bottom of the tube
Combine 7 µL RT reaction mix (above) with 13 µL of the annealed mix, mix well by gently pipetting up and down at least 10 times, then centrifuge briefly to collect the solution to the bottom of the tube
Incubate as below
AB
Temp (C)Time (m)
4290
855
41

Index PCR
2h 37m 30s

AB
ComponentVolume (μl)
10 µM Forward Index Primer 2.5
10 µM Reverse Index Primer 2.5
RiboS_blocking_oligo 2
2X Phusion Master Mix 25
TSO reaction 18
PCR components

ABC
CyclesTemp (C)Time (s)
19830
10985
605
17210
PCR cycle parameters (for selection of <40bp inserts)

Fragment is 150bp excluding insert at this stage
AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNGATGGG[INSERT]CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
Add 90 µL AMPure XP beads to the PCR product
Incubate at Room temperature for 00:05:00
Place on a magnetic rack
Aspirate supernatant
Add 200 µL 70 % (v/v) ethanol
Wait for 00:00:30
Aspirate and discard the supernatant
Add 200 µL 70 % (v/v) ethanol
Wait for 00:00:30
Aspirate and discard the supernatant
Resuspend beads in 10 µL of H20
Incubate for 00:02:00
Transfer to a clean PCR tube
8m
Optional: Agarose gel size selection
Run a 1% agarose gel, excise the desired band, and perform a gel cleanup.
Optional: Depletion of Abundant Sequences by Hybridization
To perform DASH to deplete unwanted sequences (e.g., rRNA) follow the protocol here.
Quantification
Run a tapestation or bioanalyzer chip
Do qubit or qPCR using an Illumina library quant kit to quantify the library and pool the samples (see Illumina Sequencing Coverage Calculator for pooling information)
Analysis
Analysis can be done using common pipelines with the addition of umi_tools to count unique reads
Protocol references
Ingolia, N., Brar, G., Rouskin, S.et al.The ribosome profiling strategy for monitoring translationin vivoby deep sequencing of ribosome-protected mRNA fragments.Nat Protoc7, 1534–1550 (2012). https://doi.org/10.1038/nprot.2012.086