Dec 29, 2025

Rapid On-Site Detection of Crop RNA Viruses Using CRISPR/Cas13a V.2

DOI
https://dx.doi.org/10.17504/protocols.io.j8nlk9wb5v5r/v2
  • Hagit Hak1,
  • Steffen Ostendorp2,
  • Anton Reza2,
  • Shany Ishgur Greenberg3,
  • Gur Pines4,
  • Julia Kehr2,
  • Ziv Spiegelman1
  • 1Department of Plant Pathology and Weed Research, Agricultural Research Organization - Volcani Institute, Rishon LeZion, Israel;
  • 2Department of Biology, Institute of Plant Science and Microbiology, Universität Hamburg, Hamburg, Germany;
  • 3Extension Service, Ministry of Agriculture and Rural Development, Beit Dagan 50250, Israel;
  • 4Department of Entomology, Agricultural Research Organization - Volcani Institute, Rishon LeZion, Israel
Hagit Hak
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.j8nlk9wb5v5r/v2
Protocol Citation: Hagit Hak, Steffen Ostendorp, Anton Reza, Shany Ishgur Greenberg, Gur Pines, Julia Kehr, Ziv Spiegelman 2025. Rapid On-Site Detection of Crop RNA Viruses Using CRISPR/Cas13a. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlk9wb5v5r/v2Version created by Hagit Hak
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 29, 2025
Last Modified: December 29, 2025
Protocol  Integer ID: 235993
Keywords: CGMMV, Diagnostics, On-site, Tomato brown rugose fruit virus, ToBRFV, TuMV, site detection of crop rna virus, site detection of plant virus, crop rna virus, cas13a crispr, plant virus, using crispr, crispr, nucleic acid, virus, nucleic acids sequence, site detection, rna, rnasealert, concentration of rnasealert
Funders Acknowledgements:
Israeli Ministry of Agriculture and Rural Development
Grant ID: 20-02-0187
National Center for Genome Editing Applications and Technologies in Agriculture
Grant ID: 20-01-0209
European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation programme
Grant ID: 810131
Deutsche Forschungsgemeinschaft
Grant ID: DFG; GA No. 433194101, Research Unit 5116
Abstract
CRISPR/Cas technology is an emerging tool for the identification of nucleic acids sequences. Here, we present a user-friendly, extraction-free, rapid protocol for specific on-site detection of plant viruses using CRISPR/Cas13a.

Version 2: corrected the concentration of RNaseAlert in step 9 (from 200μM to 200nM).

Materials
Before starting:

  • crRNAs – synthetic RNA oligos
  • LbuCas13a
  • RNaseAlert® substrate (IDT, Coralville, USA)
  • Lysis buffer (15% polyethylene glycol 4000, 20 mM NaOH)
  • Reaction buffer:
AB
407 Hepes pH 6.820 mM
KCl50 mM 
MgCl25 mM
Glycerol5%
  • A healthy plant to serve as control.

Equipment:

  • P51™ Molecular Fluorescence Viewer from MiniPCR Bio (Cambridge, MA, USA) Mobile phone with camera

Nuclease assay:
Mix the following
AB
Reaction buffer5 μL
RNPs1 μL (100 nM final volume) 
RNaseAlert ® substrate (IDT, Coralville, USA)1 μL (200 μM final volume)
Crude RNA3 μL


crRNAs
Design 23-long crRNAs that complement the RNA sequence of the virus of interest.
Order the crRNAs fused to the 3' end of the LbuCas13a stem (5’GACCACCCCAAAAAUGAAGGGGACUAAAAC 3’).

Resuspend crRNA oligos with molecular grade water to 1 micromolar (µM) .

RNP Assembly
30m
Mix crRNA with LbuCas13a at a 1:1 ratio. Incubate at Room temperature for 00:30:00 .

30m
RNPs can be stored at -20 °C for up to at least 6 months.

On-site: Crude RNA Extraction
5m 5s
Punch a 1 cm leaf disc and place in 300 µL of lysis buffer.

Incubate at Room temperature for 00:05:00 .

5m
Shake vigorously for 00:00:05 .

Note
Use immediately or place On ice .

5s
On site: Nuclease Assay
10m
Mix the following in a PCR tube:
AB
Reaction buffer5 μL
RNPs1 μL (100 nM final volume)
RNaseAlert substrate (IDT, Coralville, USA)1 μL (200 nM final volume)
Crude RNA3 μL
Incubate at Room temperature for 00:10:00 .

10m
View fluorescence using P51™ Molecular Fluorescence Viewer. Since exposure to light interferes with fluorescence, it's best to place the Fluorescence Viewer in a dark box (we use a small shoebox).

Take a photo with any mobile phone camera. It is better to set the brightness to a medium level.

Compare fluorescence levels of tested plants with that of the control.

Optional: Fluorescence quantification using ImageJ (https://imagej.net/ij/).

Select an area of the liquid in the tube. Be careful not to include reflections of the LED lights. Measure grayscale by clicking Analyze -> Measure. Compare Mean value with that of a control sample.