Jan 24, 2025
Rapid multiplexed nanopore amplicon sequencing of Plasmodium falciparum microhaplotype loci
- 1Swiss Tropical and Public Health Institute;
- 2University of Basel
Protocol Citation: Aurel Holzschuh 2025. Rapid multiplexed nanopore amplicon sequencing of Plasmodium falciparum microhaplotype loci. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbrqnqlpk/v1
Manuscript citation:
Aurel Holzschuh, Anita Lerch, and Christian Nsanzabana. "Multiplexed
nanopore amplicon sequencing to distinguish recrudescence from new
infection in antimalarial drug trials." bioRxiv (2024): 2024-09.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 14, 2025
Last Modified: January 24, 2025
Protocol Integer ID: 118309
Keywords: malaria, nanopore, amplicon, microhaplotypes, multiplex, falciparum, PCR-correction
Abstract
This protocol outlines a multiplexed nanopore amplicon sequencing (AmpSeq) panel targeting six highly diverse P. falciparum microhaplotype loci.
Materials
Reagents
| Item | Supplier | Item code | |
| Qubit™ 1X dsDNA High Sensitivity (HS) Assay Kit | ThermoFisher | Q33231 | |
| Primers (see below) | |||
| KAPA HiFi HotStart ReadyMix | Roche | KK2601 | |
| Native Barcoding Kit 96 V14 | ONT | SQK-NBD114.96 | |
| NEB Blunt/TA Ligase Master Mix | NEB | M0367 | |
| NEBNext Ultra II End repair/dA-tailing Module | NEB | E7546 | |
| NEBNext Quick Ligation Module | NEB | E6056 | |
| AMPure XP beads | Beckman Coulter | A63880 | |
| R10.4.1 flow cell | ONT | FLO-MIN114 | |
| (Optional) Flow Cell Wash Kit | ONT | EXP-WSH004 |
Plasticware and laboratory basics such as ethanol, nuclease-free water and TE buffer are not included.
Since this protocol uses a higher ratio of magnetic beads than the standard ONT protocol, additional AMPure XP beads are required. Magnetic beads from other manufacturers may also work, but this is at your own risk as we have not tested them.
Primer pool of microhaplotypes
| Primer | Sequence | Quantity | Formulation | |
| ama1_fw | GAACTCAATATAGACTTCCATCAGG | 250 nmole | STD | |
| ama1_rv | CCTGCATGTCTTGAACATAAAGTC | 250 nmole | STD | |
| celtos_fw | CTGGTACTATTATACCATATGTTGC | 250 nmole | STD | |
| celtos_rv | TCACCAACCTTTTTAGAATCAAGC | 250 nmole | STD | |
| cpmp_fw | GGAAGCTATAGGTATCAGATCC | 250 nmole | STD | |
| cpmp_rv | TAGAATACGTGCTTTATAAACAAAGAG | 250 nmole | STD | |
| cpp_fw | AACACAATCTTCCTTAGCCAATTC | 250 nmole | STD | |
| cpp_rv | ATTACTACCTTTCAGCATATCCGA | 250 nmole | STD | |
| csp_fw | GACCCAAACCGAAATGTAGATG | 250 nmole | STD | |
| csp_rv | GAGCCAGGCTTTATTCTAACTTG | 250 nmole | STD | |
| surfin1.1_fw | CACCAAAATATTATATACCACAAGAC | 250 nmole | STD | |
| surfin1.1_rv | GGAAAATCTTTGGTGGGAAAAATAG | 250 nmole | STD |
Preparation of primer pool
Preparation of primer pool
Prepare multiplex primer pool (see Materials)
If you have ordered the primers lyophilised, make them up to 500 micromolar (µM) in TE Buffer (1X Solution pH 8.0, Low EDTA) in a 1.5mL Eppendorf DNA LoBind® Tube.
Store the resuspended primer stocks at -20 °C .
Prepare the primer pool by adding the indicated volume (see table below) of each forward and reverse500 micromolar (µM) primer stock to the primer pool. Fill up with nuclease-free H2O to a total of 500 µL (130 µL fw and rv primers and 370 µL nuclease-free H2O).
| Fw Primer | Rv Primer | Amplicon size (bp) | Vol. in Pool (μL) | Final conc. in PCR reaction (µM) | |
| ama1_fw | ama1_rv | 201 | 7 | 0.14 | |
| celtos_fw | celtos_rv | 123 | 15 | 0.3 | |
| cpmp_fw | cpmp_rv | 192 | 10 | 0.2 | |
| cpp_fw | cpp_rv | 184 | 8 | 0.16 | |
| csp_fw | csp_rv | 143 | 10 | 0.2 | |
| surfin1.1_fw | surfin1.1_rv | 175 | 15 | 0.3 |
The volume indicated is for each of the fw and rv primer to add.
Multiplex PCR
Multiplex PCR
Prepare KAPA HiFi HotStart ReadyMix (KK2601) master mix.
Vortex reagents to mix and briefly spin down before opening.
Generic recipe (without extra % for dead volumes):
| Reagent | Volume (µL) | |
| 2X KAPA HiFi HotStart ReadyMix | 12.5 | |
| Multiplex Primer Pool (7-15 μM) | 0.5 | |
| Nuclease-Free H2O | 8 | |
| TOTAL | 21 |
Note
Instead of the KAPA HiFi HotStart ReadyMix (KK2601) kit, the KAPA HiFi HotStart PCR Kit (KK2501) kit can also be used.
Aliquot 21 µL PCR mix into PCR tubes/wells (single tubes, strips or plate). Keep tubes On ice .
Add DNA
Add 4 µL DNA sample to each labeled tube/well.
Close tubes or cover plate with seal. Vortex and spin down before proceeding.
25 µL final volume
Run PCR reaction on a thermocycler
| Step | Temp (ºC) | Time | No. cycles | |
| Initial denaturation | 95 | 3 min | 1 | |
| Denaturation | 98 | 15 sec | 35 | |
| Annealing | 56 | 15 sec | 35 | |
| Extension | 72 | 30 sec | 35 | |
| Final Extension | 72 | 2 min | 1 | |
| Hold | 4 | Forever | 1 |
Nanopore library preparation
Nanopore library preparation
Nanopore library preparation is performed following the "Native Barcoding Kit 96 V14 (SQK-NBD114.96)" protocol from Oxford Nanopore Technology (ONT) with some modifications.
Note
Alternatively, if only few samples are being processed, the "Native Barcoding Kit 24 V14 (SQK-NBD114.24)" can also be used.
Make the following changes to the protocol as indicated below:
End-prep step
Omit the DNA Control Sample (DCS) and instead make up each sample to 12.5 µL nuclease-free H2O. Aim for 500 - 1000 fmol total per sample.
Note
We recommend including P. falciparum positive controls (e.g., mixture of known laboratory strains) in every sequencing run.
Increase the incubation times for the end-prep to 20 °C for 00:15:00 and 65 °C for 00:15:00 .
(Optional) Perform a clean-up of the PCR products using AMPure XP beads at a 1.6X ratio (i.e., 24 µL for a 15 µL sample). A clean-up is recommended if possible.
Quantify 1 µL of eluted sample using a Qubit fluorometer.
Native barcode ligation
Take forward an equimolar mass of each sample to be barcoded. Aim for a minimum of >200 fmol total per sample (but this can also be higher).
Make up each end-prepped DNA sample to a maximum of 3.75 µL in nuclease-free H2O.
Note
If the DNA concentration varies greatly from sample to sample, it may be necessary to dilute some of the sample. If the amplicon yields are less than 200 fmol, use the entire 3.75 µL for this sample.
Increase the incubation time to 00:30:00 at room temperature.
Perform the clean-up step with AMPure XP beads using a 1X ratio instead of 0.4X.
Elute the pooled samples in 50 µL instead of 35 µL nuclease-free H2O.
Note
The elution volume can be adjusted depending on how much DNA was taken forward. However, the increased volume helps with elution of the DNA as a higher beads ratio is used compared to the standard protocol.
If overall DNA concentration is low, consider eluting the sample in 35 µL .
Adapter ligation
Increase the incubation time to 00:30:00 at room temperature.
Perform the clean-up step with AMPure XP beads using a 1X ratio instead of 0.4X (i.e., use 50 µL of beads instead of 20 µL ).
Use short fragment buffer (SFB) for washing the beads to purify all fragments equally.
Elute the pooled samples in 20-25 µL Elution Buffer (EB).
Prepare the library to a final volume of 12 µL at 100 - 300 fmol.
Note
The ONT protocol recommends loading 100 fmol for very short (<1 kb) amplicons. We have tried loading up to 300 fmol and did not observe any pore clogging.
Nanopore sequencing
Nanopore sequencing
Loading SpotON flow cell (R10.4.1)
Load final library (at 100 - 300 fmol) according to ONT protocol.
Note
Because the amplicons are so short, a large number of reads are generated in a very short time. With a new flow cell (R10.4.1) of good quality and good pore occupancy, nearly 1 million reads can be generated in 1 hour.
We recommend to aim for 60,000 - 120,000 reads per sample, so that ~10,000 - 20,000 reads per marker are obtained. In our protocol, we will remove low quality reads (below Q20), thus removing a portion of the reads prior to haplotype inference.
(Optional) If the desired number of reads has been obtained and the flow cell has a fair amount of pores remaining (>500), the run can be stopped and the flow cell washed with the Flow Cell Wash Kit (ONT) and reused later.
Processing of raw nanopore data after sequencing
For optimal results, we recommend performing basecalling and demultiplexing using dorado with the following settings:
dorado basecaller dna_r10.4.1_e8.2_400bps_sup@v5.0.0 <reads> --kit-name SQK-NBD114-96 --min-qscore 20 --barcode-both-ends > calls.bam
dorado demux --output-dir <output-dir> --no-classify --emit-fastq <input-bam>