License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
In this lab protocol, we will outline a step-by-step procedure for cloning of spCas9 sgRNAs using oligo annealing and T4 ligation. This protocol will guide you through the crucial steps of designing, annealing, ligating oligonucleotides and digested plasmids, as well as heat shock transformation procedure to clone sgRNAs expression vectors.
DNA Gel Loading Dye (6X)Thermo Fisher ScientificCatalog #R0611
Macherey-Nagel™ NucleoSpin™ Gel and PCR Clean-up KitFischer ScientificCatalog #11992242
NucleoSpin Plasmid Transfection-grade, Mini kit for ultrapure plasmid DNAMacherey-NagalCatalog #740490.250
T4 DNA Ligase Buffer (10X)Thermo FisherCatalog #B69
AarI (2 U/µL)Thermo FisherCatalog #ER1581
T4 DNA Ligase (5 U/µL)Thermo FisherCatalog #EL0011
Troubleshooting
Safety warnings
Wear gloves and a UV filter mask and ensure sleeves are completely covering wrists to avoid direct UV light exposure
Before start
Modify the ssOligo overhangs and Sanger sequencing primer according to the plasmid that you are using.
Oligo Design
Order TOP and BOTTOM strand oligos, where the TOP sequence is the desired 20 nt sgRNA 'spacer' sequence and the BOTTOM sequence is the reverse complement of the TOP strand. After annealing of both oligos, the 5' overhangs should result in compatible sticky ends for T4 ligation into the target vector. Shown are example sticky ends to clone into the vector sgLenti (Addgene #105996). Alternative sgRNA expression vectors may require different sticky ends.
Digested Plasmid Purification by Agarose Gel Electrophoresis
3h
Prepare 1 % Agarose gel
30m
Add 4 µL of 6x DNA Gel Loading Dye (6X)Thermo Fisher ScientificCatalog #R0611 to 20 µL of the restriction digestion mix.
10m
Load samples on the 1 % Agarose gel and run the electrophoresis at 120 V for 50 min
1h
Place the gel in a UV light box
Safety information
Wear gloves and a UV filter mask and ensure sleeves are completely covering wrists to avoid direct UV light exposure
10m
Cut the digested plasmid band from the gel and purify the DNA using the Macherey-Nagel™ NucleoSpin™ Gel and PCR Clean-up KitFischer ScientificCatalog #11992242
1h
Determine the concentration of the purified plasmid DNA (e.g. NanoDrop One)
10m
Ligation of Plasmid and Annealed Oligos
30m
Dilute the annealed oligos 1:200 in ddH2O
10m
Set up the ligation reaction:
50 ng purified vector
As a control set up a ligation reaction without oligos
10m
Incubate for 10 min at Room temperature
10m
Heat Shock Transformation of the Ligation Product into Chemically Competent E. Coli
1d
Take DH5a chemocompetent cells from -80 °C storage and thaw on ice for 30 min. Use 1 50 µL aliquot for the ligation reaction and 1 50 µL aliquot for the control reaction
30m
Add 2 µL of the T4 Ligation reaction and the control reaction to the cells and mix gently by flicking the tube
Incubate on ice for 30 min
30m
Incubate the tube containing the cells in a water bath at 42 °C for 45 sec and place back on ice for 2 min
2m 45s
Add 0.5 mL of LB medium to the cells and incubate in a thermo-block at 37 °C with shaking at 250 rpm for 1 hr
1h
Plate 100 µL of the cells on Room temperature LB agar plates with 100 µg/mL Carbenicillin
10m
Incubate at 37 °COvernight
16h
After the overnight incubation, count the colonies on the ligation reaction and the control plates. The ligation reaction plate should have a minimum of 10x more colonies.
10m
Seal the plates with parafilm and store at 4 °C for up to 2 weeks
Plasmid DNA Pr1dification
1d
Pick up to 3 colonies from the plate using a pipette tip and inoculate 5 mL LB medium with 100 µg/mL Carbenicillin in 15 mL cell culture tubes
Incubate the cell culture tubes Overnight at 37 °C and 225 rpm in a shaking incubator
16h
Extract the plasmid DNA using the NucleoSpin Plasmid Transfection-grade, Mini kit for ultrapure plasmid DNAMacherey-NagalCatalog #740490.250
1h 30m
Measure the concentration of the purified plasmid DNA (e.g. NanoDrop One)
Send the plasmids for Sanger sequencing with the following primer to confirm the correct sequence:
GGCTTGGATTTCTATAACTTCGTATAGCA
Note
Provided primer is complementary to the 'sgLenti vector for CRISPR sgRNA expression' provided in the attachments and needs to be adjusted for alternative vectors.