Mar 08, 2024

Rabies Virus Bat-Clade Sequencing V.2

Rabies Virus Bat-Clade Sequencing
  • 1Secretaria Estadual da Saúde do Rio Grande do Sul;
  • 2UFRGS;
  • 3FIOCRUZ
Icon indicating open access to content
QR code linking to this content
Protocol CitationFernanda Godinho, Aline Campos, rosana-huff , Amanda Ruivo, Milena Bauermann, Thales Bermann, Gabriel Luz Wallau, Paulo Michel Roehe, Richard Salvato 2024. Rabies Virus Bat-Clade Sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5x3bng1b/v2Version created by Richard Salvato
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 07, 2024
Last Modified: March 08, 2024
Protocol  Integer ID: 96309
Keywords: rabies, viruses, genomics, sequencing, global genomic surveillance of the rabies virus, genomic surveillance protocols for rabv, limited complete genome sequence data of rabv, rabies virus bat, protocol for the rabies virus, rabies virus, initial rabies virus diagnosis, clade sequencing, advancing global genomic surveillance, establishing genomic surveillance protocol, protocol for rabv bat, impact zoonotic virus, zoonotic virus, genomic surveillance, rabv sequence, limited complete genome sequence data, rabv bat, sequencing protocol, sequencing, sequencing approach, targeting viral control program, emerging zoonotic disease, whole genome, genomic perspective, complete rabv, rabv, importance of rabv, viral control program, covidseq, hosts as bat, zoonotic disease, bat, zoonotic cycle, clade in order, clade, wildlife reservoir, fatal encephalitis in domestic animal, dna prep, different species, wider diversity of host
Funders Acknowledgements:
FAPERGS
Grant ID: 23/2551-0000510-7
FAPERGS
Grant ID: 23/2551-0000852-1
FAPERGS/CNPQ
Grant ID: Programa de Apoio à Fixação de Jovens Doutores no Brasil
Disclaimer

This sequencing protocol is shared informally, and its use is at the discretion of the recipient. We make no guarantees or warranties, express or implied, regarding the accuracy, completeness, or fitness for any particular purpose of this protocol.

The information provided is intended solely for informational and collaborative purposes. Users are solely responsible for conducting their own due diligence, quality control, and validation to ensure that the protocol aligns with their specific research objectives and adheres to all applicable legal and ethical guidelines. Any reliance on the protocol is at the user's own risk. This protocol does not constitute professional advice, and any application or implementation should be carried out by appropriately trained and qualified personnel.
Abstract
Join us in advancing global genomic surveillance of the rabies virus.

We are actively engaged in pioneering a pan-clade whole genome amplicon sequencing protocol for the rabies virus. If you're interested in collaborating on this crucial endeavor and wish to obtain a primer aliquot from our established protocol or the one currently in development, please do not hesitate to contact us at [email protected].

Background

Rabies virus (RABV) causes fatal encephalitis in domestic animals and humans. This high-impact zoonotic virus is poorly studied from the genomic perspective so establishing genomic surveillance protocols for RABV is crucial to track their evolution and monitor spillover events and wildlife reservoirs.

Despite the importance of RABV zoonotic cycle, there is limited complete genome sequence data of RABVs from some hosts as bats. We developed a novel rapidly deployable, cost-effective, and flexible amplicon-based sequencing approach usable with protocols widely established during the COVID-19 pandemic and suitable to different hosts based on a one-health context. We used PrimalScheme to generate a primers panel and then aligned them with a RABV sequences dataset from different species and manually degenerated the primers to cover a wider diversity of hosts.

The set of 47 primers is compatible and ready to use with COVIDSeq sequencing protocol and Illumina DNA Prep, and allows to sequence up to 384 samples per run on the Illumina MiSeq system or to accommodate in libraries with other sample types. Additionally, we included primers for amplification of a fragment of the mitochondrial gene COI to host species identification.

Initial Validation

In the initial validation, we sequenced 160 complete RABV genomes from different species from five distinct families (Bovine, Equine, Caprine, Felines, Microchiroptera) with an average coverage of 98%, most of them recovering the whole genome (88/160).

Conclusions

Here, we introduced a cost-effective and easy-to-use sequencing protocol for RABV bat-clade in order to support genomic surveillance of a re-emerging zoonotic disease allowing targeting viral control programs and adequate public health policies.

Acknowledgements

We would like to thank Instituto de Pesquisas Veterinárias Desidério Finamor for sample processing and initial rabies virus diagnosis.




Materials



ABCD
primersequencepool
raiva__1_LEFTATGTGGAAGGRARTTGGGCTCT1
raiva__1_RIGHTTTGACKGTTCCGTCATCTGCC1
raiva__2_LEFTCATGAGATGTCWGTTCTTGGRGG2
raiva__2_RIGHTGTGACATAGGATATGATCTCCTCRAC2
raiva__3_LEFTAGATTTTTGTCARYCCAAGTGCG1
raiva__3_RIGHTCATCTCAGAGGGAGYTTGGATCC1
raiva__4_LEFTTGAARATGAACCTTGAYGACATAGTC2
raiva__4_RIGHTCATGTTRATACACCAAATYCTKCC2
raiva__5_LEFTGAACTGGGTATAYAARTTGAGGAGAAC1
raiva__5_RIGHTCTTGAATGTGGTRGTGACATAACC1
raiva__6_LEFTAAGGTGGGRTACATMTCYGCCA2
raiva__6_RIGHTTATGCCTTYCCAAAYCCMGG2
raiva__7_LEFTACYGTAAARACCACYAARGAGT1
raiva__7_RIGHTACAGARGACTCYARCAGCTCCA1
raiva__8_LEFTTRATGAKTGCAGGTGSTCTGG2
raiva__8_RIGHTCTTAAGATRTTGGGRAYGGYGGG2
raiva__9_LEFTRACAGACAAYTGYTCKAGGTCWTACA1
raiva__9_RIGHTCCTCMAGYTGACYCACCTTRTCYC1
raiva__10_LEFTCCTTGGAYTGGGATGARGAGAA2
raiva__10_RIGHTTGTTTGGGAGGCCAYGTYTG2
raiva__11_LEFTCYAAATGGTATCTTGATYCGCGAC1
raiva__11_RIGHTYTGACATGTCCAGACARTATATTTGATC1
raiva__12_LEFTTCTGTACTYGATCAAGTGTTYGGA2
raiva__12_RIGHTGARAACTGACGTATRTGGAACCTT2
raiva__13_LEFTGCTGTMTTCCATTACYTGCTST1
raiva__13_RIGHTCCCAACATYTCAGAGGGRTGRG1
raiva__14_LEFTSATGACMCAGACTCCCCAAAGG2
raiva__14_RIGHTGCACDGCTCCMGAAACCATTCTA2
raiva__15_LEFTTTGGCATCTTMGATGTAACAAGTG1
raiva__15_RIGHTGARCTCATTTGTCKYAAGTTGG1
raiva__16_LEFTTCWGACTTTAGAAGYTCYAAGATGAC2
raiva__16_RIGHTGTGACCTCHGCATCACAAATGA2
raiva__17_LEFTTGATGGCRTCAGGRACACAYC1
raiva__17_RIGHTCTGCAGCATATGTTGAAGTGTCTC1
raiva__18_LEFTGYTDATGTCTGATTTTGCAYTRTC2
raiva__18_RIGHTTCARCCTGATCCAGTGAGAWGA2
raiva_extra_1_LEFTACGCTTAACRACAAAATCAG2
raiva_extra_1_RIGHTATGTTTGTCTTGTAATTGCC2
raiva_extra_2_LEFTATATTCAACAAGACYTTRAT2
raiva_extra_2_RIGHTGTACAACTCCCATGARGATA2
raiva_extra_3_LEFTCGAYTTGCCTCCTATGAAGG1
raiva_extra_3_RIGHTAGCCAAAGGGAGATCATMGA1
raiva_extra_4_LEFTTACAACAGACCCATAACYTA1
raiva_extra_4_RIGHTACGCTTAACAAAAAAACAATAAAGAT1
raiva_extra_5_RIGHTACTTGGAACGAGATCATCCC2
raiva_extra_5_LEFTACCTATGAAGGACACAAGCAA2
raiva_extra_5_LEFTBCCTATGAAGGACCCTAGCAA2
Mod_RepCOI_FTNTTYTCMACYAACCACAAAGA 1
Mod_RepCOI_RTTCDGGRTGNCCRAARAATCA2
VertCOI_7194_FCGMATRAAYAAYATRAGCTTCTGAY2
VertCOI_7216_RCARAAGCTYATGTTRTTYATDCG1
Primers sequences and respective pools

Primer Preparation
Reconstitute each primer shown in Table 1 (See Materials section), using nuclease-free water to get a 100 µM stock solution.

Prepare RABV-BAT primer pools A and B as described here.
Separate all primers at 100 µM into two separate boxes labeled as Pool A and Pool B, according to Table 1.
Label a 2.0 ml microtube as Pool A and another as Pool B.
Vortex and spin down all the primers tubes.

Add 5 µL of each 100 µM primer from Pool A into the tube labeled as Pool A.
Add 5 µL of each 100 µM primer from Pool B into the tube labeled as Pool B.

Add 1080 µL of nuclease-free water into the tube with Pool A.
Add 1215 µL of nuclease-free water into the tube with Pool B.

Now you have Pool A and B at a concentration of 10 µM and ready to use.
Pooled Primers Can Be Stored at -20 °C


Sample Extraction and Cycle threshold (Ct) determination
28m 45s
Samples were extracted as described below and we used a previously published Real-time RT-PCR on all samples to determine viral load with Cycle threshold (Ct) value. Samples with a Ct value <28 are recommended for optimal results.

A total of200 µL of homogenate samples, containing 50 mg of brain tissue fragments macerated in Basal Medium Eagle (BME), were added to 800 µL of TRIzolTM Reagent (Invitrogen, Grand Island, NY, USA) in 2.0 ml microtubes.
The tissue was disrupted using a vortex at maximum speed for 00:00:15 , followed by Room temperature incubation for 00:05:00 and then 180 µL of chloroform was added.
5m 15s
The tissue was disrupted using a vortex at maximum speed for 00:00:15 , followed by Room temperature incubation for 00:05:00 and then 180 µL of chloroform was added.
5m 15s
The mixture was mixed for 00:00:15 , incubated at Room temperature for 00:03:00 , and centrifuged at 12000 rcf at 4 °C for 00:15:00 .

18m 15s
Viral RNA extraction was carried out using 200 µL of supernatant using a commercially available Extracta Kit Fast – DNA e RNA Viral (MVXA-PV96-B FAST) and the Loccus Extracta 96 equipment (Loccus, Sao Paulo, Brazil) following the manufacturer’s instructions. Extracted RNA samples were stored at −80◦C until tested by RT-qPCR.
For Cycle threshold (Ct) determination TaqMan single-step RT-PCR assay was conducted according previously described by Crystal Gigante (See protocol below).

cDNA synthesis and amplification of amplicons can be performed using the Illumina COVIDSeq Test (RUO version) or Illumina DNA Prep. Choose one of these approaches below.
Step case

Illumina COVIDSeq Test (RUO version)
27 steps

This step reverse transcribes the RNA fragments primed with random hexamers into first-strand cDNA using reverse transcriptase.

* Include a negative PCR control (NTC; nuclease-free water) for each pool.
Label new PCR plate CDNA1.
Add 8.5 µL EPH3 to each well.

Add 8.5 µL eluted sample to each well.

Seal and shake at 1600 rpm for 00:01:00 .

1m
Centrifuge at 1000 × g for 1 minute.
Place on the preprogrammed thermal cycler and run the COVIDSeq Anneal program.

COVIDSeq Anneal program:
- Choose the preheat lid option - Set the reaction volume to 17 µl - 65°C for 3 minutes - Hold at 4°C
In a 1.7 ml tube, combine the following volumes to prepare First Strand cDNA Master Mix.
*Multiply each volume by the number of samples.

FSM 9 µL
RVT 1 µL

Reagent overage is included to account for small pipetting errors.

Add 8 µL master mix to each well of the CDNA1 plate.

Seal and shake at 1600 rpm for 00:01:00 .

1m
Centrifuge at 1000 x g for 00:01:00 .

1m
Place on the preprogrammed thermal cycler and run the COVIDSeq FSS program.

COVIDSeq FSS program:

- Choose the preheat lid option - Set the reaction volume to 25 µl - 25°C for 5 minutes - 50°C for 10 minutes - 80°C for 5 minutes - Hold at 4°C


Amplicon Generation
This step uses two separate PCR reactions to amplify cDNA using the previously prepared primers pool A and B.
* Include a negative PCR control (NTC; nuclease-free water) for each pool.

Label two new PCR plates POOL A and POOL B. The plates represent two separate PCR reactions.
In a 15 ml tube, combine the following volumes to prepare PCR 1 Master Mix and PCR 2 Master Mix. Multiply each volume by the number of samples.
*Reagent overage is included to account for small pipetting errors.

ABC
ReagentPCR 1 Master Mix (µl) PCR 2 Master Mix (µl)
IPM 1515
RABV-BAT Pool A4.3N/A
RABV-BAT Pool BN/A4.3
Nuclease-free water4.74.7

Add 20 µL PCR 1 Master Mix to each well of the POOL A plate corresponding to each well of the CDNA1 plate.

Add 5 µL first strand cDNA synthesis from each well of the CDNA1 plate to the corresponding well of the POOL A plate.

Add 20 µL COVIDSeq PCR 2 Master Mix to each well of the POOL B plate corresponding to each well of the CDNA1 plate.

Add 5 µL first strand cDNA synthesis from each well of the CDNA1 plate to the corresponding well of the POOL B plate.

Seal and shake at 1600 rpm for 00:01:00 .

1m
Centrifuge at 1000 x g for 00:01:00 .

1m
Place in the preprogrammed thermal cycler and run the COVIDSeq PCR program.

COVIDSeq PCR program:

- Choose the preheat lid option - Set the reaction volume to 25 µl - 98°C for 3 minutes - 35 cycles of: ---- 98°C for 15 seconds ---- 63°C for 5 minutes - Hold at 4°C

*Safe Stopping Point:

Amplicons can be stored at -20 °C until ready to use

Amplicon checking
1m
We recommend using agarose gel electrophoresis or automated electrophoresis to check the amplicons before proceeding to library construction.
Library preparation
The following steps were conducted according to the standard protocol, starting from "Tagment PCR Amplicons" step on page 9.

Download illumina-covidseq-ruo-kits-reference-guide-1000000126053-08.pdfillumina-covidseq-ruo-kits-reference-guide-1000000126053-08.pdf785KB

Tagment PCR Amplicons Post Tagmentation Clean Up Amplify Tagmented Amplicons Pool and Clean Up Libraries Quantify and Normalize Libraries Pool and Dilute Libraries Prepare for Sequencing

Sequencing
The sequencing can be performed in any Illumina platform or flowcell using 2x150 nt reads.

Note
For sequencing, we recommend generating at least 50,000 reads per sample or 100,000 reads for optimal sequencing coverage.


Bioinformatics Analysis
Sequencing reads should be analyzed by an amplicon-based sequencing pipeline. We recommend using ViralFlow Workflow which performs several genomic analyses based on reference genome assembly. See details at https://viralflow.github.io/

From our experience, better coverage and depth are obtained when using subclade-specific references. So, we usually assembly the sequences using the bat clade reference (JQ685956), then we run the consensus resulting sequence at http://rabv-glue.cvr.gla.ac.uk/ typing tool, and getting the nearest reference we re-assembly using this reference genome.

Reference Sequence
Download JQ685956.fastaJQ685956.fasta11KB

BED file
Download JQ685956.bedJQ685956.bed1KB

COI Analysis

COI amplicon analysis can be performed using ampliseq pipeline, an amplicon sequencing analysis workflow using DADA2 and QIIME2.