Jul 08, 2024

qPCR standard for library quantification V.2

qPCR standard for library quantification
  • 1Max Planck Institute for Evolutionary Anthropology
  • MPI EVA Ancient DNA Core Unit
Icon indicating open access to content
QR code linking to this content
Document CitationAyinuer Aximu Petri, Matthias Meyer 2024. qPCR standard for library quantification. protocols.io https://dx.doi.org/10.17504/protocols.io.bp2l6xwd5lqe/v2Version created by Ancient DNA Core Unit
License: This is an open access  document  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Created: July 08, 2024
Last Modified: July 08, 2024
Document  Integer ID: 102968
Keywords: dna library quantification, qpcr standard for library quantification protocol, quantitative pcr, dna library, sequencing of dna, stranded dna library, nucleic acids research, qpcr standard, throughput sequencing, time pcr, degraded dna, library quantification protocol, dna, ancient biological remain, sequencing, nucleic acid
Funders Acknowledgements:
Max Planck Society
Abstract
Protocol for the preparation of a standard for DNA library quantification by quantitative real-time PCR (Meyer et al. 2008; Gansauge et al. 2020).

References

Meyer, M., Briggs, A. W., Maricic, T., Höber, B., Höffner, B., Krause, J., Weihmann, A., Pääbo, S., & Hofreiter, M. (2008). From micrograms to picograms: Quantitative PCR reduces the material demands of high-throughput sequencing. Nucleic Acids Research, 36(1): e5.

Gansauge, M.-T., Aximu-Petri, A., Nagel, S. et al. Manual and automated preparation of single-stranded DNA libraries for the sequencing of DNA from ancient biological remains and other sources of highly degraded DNA. Nature Protocols,15, 2279-2300 (2020).

Notes

The qPCR standard comprises of a 60 bp fragment of pUC19 sequence flanked by double-indexed Illumina adapters. Indices are qPCR specific and not used for the preparation of sample libraries. The standard is obtained through two successive PCRs. It is then purified, quantified and diluted to concentrations between 102 and 108 molecules per micro liter.

Materials
Reagent/consumableSupplierCatalogue number
Reagents
Herculase II Fusion DNA Polymerase, including 5x Herculase buffer and dNTP mix (25 mM each dNTP) Agilent Technologies600675
MinElute PCR Purification KitQiagen28006
pUC19 plasmid DNANEBN3041S
Primer CL105_makeSTD103.F *IDT -
Primer CL106_makeSTD103.R †IDT -
Primer P5_iPCR_qPCR_xxQ188 ‡IDT -
Primer P7_iPCR_qPCR_xxQ §IDT -
Agilent DNA 1000 KitAgilent Technologies5067-1504
TET buffer ‖self-made
TE buffer ¶ self-made
Water, HPLC-grade
Consumables
0.2-ml PCR eight- tube stripsEppendorf®EP0030124359
1.5-ml Eppendorf LoBind TubesEppendorf®0030108051
* Order oligonucleotide CL105_makeSTD103.F at 1µmol synthesis scale (Integrated DNA Technologies, desalted).
Dissolve in TE buffer at a concentration of 100 µM. Prepare a 10 µM working dilution in water. Sequence: ACACTCTTTCCCTACACGACGCTCTTCCTCGTCGTTTGGTATGGCTTC
† Order oligonucleotide CL106_makeSTD103.R at 1µmol synthesis scale (Integrated DNA Technologies, desalted). Dissolve in TE buffer at a concentration of 100 µM. Prepare a 10 µM working dilution in water. Sequence: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCATGTAACTCGCCTTGATCGT
‡ Order oligonucleotide P5_iPCR_qPCR_xxQ188 at 1µmol synthesis scale (Integrated DNA Technologies, HPLC purified). Dissolve in TE buffer at a concentration of 100 µM. Prepare a 10 µM working dilution in water. Sequence: AATGATACGGCGACCACCGAGATCTACACCAATTCAACACTCTTTCCCTACACGACGCTCTT
§ Order oligonucleotide P7_iPCR_qPCR_xxQ at 1µmol synthesis scale (Integrated DNA Technologies, HPLC purified). Prepare a 10 µM working dilution in water. Dissolve in TE buffer at a concentration of 100 µM. Sequence: AGCAGAAGACGGCATACGAGATACCACAGTGACTGGAGTTCAGACGTGT
‖ See document in the Appendix for the preparation of TET buffer.
¶ See document in the Appendix for the preparation of TE buffer.

Equipment
  • Thermal cycler for PCR strip tubes (e.g., Bio-Rad C1000 Touch Thermal Cycler, cat. no. 1840197)
  • NanoDrop spectrophotometer (Model ND-1000 V3.8.1)
  • Agilent 2100 Bioanalyser 2100 expert DNA 1000 Series II (cat. no. G2938C)
  • Label printer (e.g. Brady M611, cat. no. M611-EU-LABS) and tube labels (e.g. labels for TLS2200/TLS PC Link/Polyester, cat. no. PTL-82-499)

Protocol
1. In a 0.2-ml PCR eight-tube strip, prepare the following reaction mix using 1ng of pUC19 plasmid DNA as template and primers CL105 and CL106. Mix properly.
ReagentsVolumeFinal concentration in reaction
5x Herculase buffer20μl1x
25 mM each dNTP1μl250µM
10 µM CL1054μl400nM
10 µM CL1064μl400nM
400 U/µl Herculase II Fusion Polymerase1μl 4U/µl
Water69μl
1 ng/µl pUC19 plasmid DNA1μl 0.01 ng/µl
sum100μl
2. Place the strip tube into a thermal cycler and perform cycling with the following temperature profile.
StepTemperatureDuration# of cycles
Initial denaturation 95°C2min1
Denaturation95°C30s25
Annealing60°C30s
Extension72°C30s
Final extension72°C5min1
Cooling10°Cforeverhold
3. Purify the PCR product using the MinElute PCR Purification Kit following the manufacturer’s instructions. Elute in 30 μl TE buffer.

4. Determine the concentration of the PCR product using the NanoDrop spectrophotometer. The expected concentration range is 50–100 ng/μl. Dilute PCR product to 1 ng / μl in TE buffer in a 1.5-ml Eppendorf LoBind tube.

5. In a 0.2-ml PCR eight-tube strip, prepare the following reaction mix use 1ng of the purified PCR product as template for a second amplification with a combination of P5 and P7 indexing primers used only for preparing the qPCR standard. Mix properly.
ReagentVolumeFinal concentration in reaction
5x Herculase buffer20μl1x
25 mM each dNTP1μl 250µM
10 µM P7_iPCR-qPCR_xxQ4μl400nM
10 µM P5_iPCR-qPCR_xxQ1884μl400nM
400 U/µl Herculase II Fusion Polymerase1μl
Water69μl
1 ng/µl PCR product dilution from step 41μl0.01 ng / µl
sum100μl
6. Place the strip tube into a thermal cycler and perform cycling with the following temperature profile.
StepTemperatureDuration# of cycles
Initial denaturation 95°C2min1
Denaturation95°C30s25
Annealing60°C30s
Extension72°C30s
Final extension72°C5min1
Cooling10°Cforeverhold

7. Purify the PCR product using the MinElute PCR Purification Kit. Elute in 30 µl TE buffer.

8. Measure the DNA concentration on a DNA-1000 chip using the Bioanalyzer 2100. Calculate the concentration of the PCR products in molecules per µl, e.g. using the Promega Biomath Calculator (https://www.promega.de/en/resources/tools/biomath/) and the Avogadro constant.

9. Dilute the purified PCR product to 109copies/µl in TET buffer in a 1.5 ml Eppendorf LoBind tube.

10. Prepare a ten-fold dilution series in TET buffer ranging from 108to 102 copies/μl as follows:
  • Prepare a ten-fold dilution (108copies/µl) by combining 100µl of the 109 dilution with 900µl TET buffer in a 1.5 ml Eppendorf LoBind tube.
  • Use the same scheme for further dilutions until reaching 102 copies/µl.

11. Aliquot 100 µl from each dilution (102 to 108 copies/μl) into the first seven wells of a 0.2 ml PCR eight-tube strip, which serves as working dilution. Leave the last well of the eight-tube strip empty. The empty well is used as a no-template-control in qPCR.

Note
[Documentation]

Label the 0.2-ml PCR eight-tube strip containing the working dilutions with "2" to "8" and NTC. Include date of creation and your initials.
Label the 1.5-ml Eppendorf LoBind tubes containing the stock dilutions with the date of creation and your initials.

12. Store stock and working aliquots at −20 °C until used.

Appendix
Document
CREATED BY
Sarah Nagel

Document
CREATED BY
Anna Schmidt