Nov 18, 2025
qPCR Duplex Panel for Detection of Antimicrobial Resistance Genes
- Leah Lariscy1,
- Abbey Wilson1,
- Carter Coleman1,
- Erin Lipp1
- 1University of Georgia
Protocol Citation: Leah Lariscy, Abbey Wilson, Carter Coleman, Erin Lipp 2025. qPCR Duplex Panel for Detection of Antimicrobial Resistance Genes. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vz9nb4gx1/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 07, 2025
Last Modified: November 18, 2025
Protocol Integer ID: 221902
Keywords: total nucleic acid samples for qpcr detection, antimicrobial resistance genes this protocol, select antimicrobial resistance gene, antimicrobial resistance gene, qpcr detection, qpcr duplex panel for detection, qpcr panel, based qpcr panel, qpcr duplex panel, purified total nucleic acid sample, custom idt primer, custom idt template control
Funders Acknowledgements:
Centers for Disease Control and Prevention Pathogen Genomics Centers of Excellence
Grant ID: NU50CK000626
Abstract
This protocol describes how to prepare purified total nucleic acid samples for qPCR detection of select antimicrobial resistance genes using a duplexed panel. The probe-based qPCR panel utilizes custom IDT primers and probes, as well as custom IDT template controls (gBlocks). This protocol has been validated for use with complex sample matrices such as raw wastewater and stool.
Materials
Reagents
TaqPath qPCR Master Mix, CG (Applied Biosystems, A15297)
Water, Molecular Biology Grade (Fisher, BP2819-1)
Custom primers (IDT)
Custom probes (IDT)
Custom gBlocks (IDT)
Equipment
Micropipettes (p10, p20, p200, p1000)
Microcentrifuge
Microplate centrifuge
Vortex mixer
CFX384 Touch Real-Time PCR Detection System (Bio-Rad, 1855484)
Consumables
1.5 mL tubes, DNA/RNAse free
0.2 mL strip tubes, DNA/RNAse free
Hard-Shell PCR Plates, 384-well, thin-wall (Bio-Rad, HSP3805)
Microseal ‘B’ Seal, optically clear (Bio-Rad, MSB1001)
Micropipette tips, DNA/RNAse free (p10, p20, p200, p1000)
Troubleshooting
Assay info
The three ARG duplexes are described below:
| A | B | C | |
| Duplex | Gene Target | CARD Accession No. | |
| ermB/tetB | ermB (Erm 23S ribosomal RNA methyltransferase) | 3000375 | |
| tetB (Tetracycline effux protein) | 3000166 | ||
| blaKPC/blaSHV | blaKPC (KPC beta-lactamase) | 3000059 | |
| blaSHV (SHV beta-lactamase) | 3000015 | ||
| blaCTX-M-1/QnrS | blaCTX-M-1 (CTX-M beta-lactamase) | 3001864 | |
| QnrS (quinolone resistance protein) | 3002790 |
Primer and probe sequences for each ARG assay are described below:
| A | B | C | |
| Gene Target | Sequence | Source | |
| ermB | GGATTCTACAAGCGTACCTTGGA (F) | Bockelmann et al., 2009 | |
| GCTGGCAGCTTAAGCAATTGCT (R) | |||
| FAM-CACTAGGGTTGCTCTTGCACACTCAAGTC-BHQ-1 (Pb) | |||
| tetB | ACACTCAGTATTCCAAGCCTTTG (F) | Knapp et al., 2010 | |
| GATAGACATCACTCCCTGTAATGC (R) | |||
| HEX-AAAGCGATCCCACCACCAGCCAAT-BHQ-1 (Pb) | |||
| blaKPC | GGCCGCCGTGCAATAC (F) | CDC, 2011 | |
| GCCGCCCAACTCCTTCA (R) | |||
| FAM-TGATAACGCCGCCGCCA ATTTGT-BHQ-1 (Pb) | |||
| blaSHV | AACAGCTGGAGCGAAAGATCCA (F) | Bockelmann et al., 2009 | |
| TGTTTTTCGCTGACCGGCGAG (R) | |||
| HEX-TCCACCAGATCCTGCTGGCGATAG-BHQ-1 (Pb) | |||
| QnrS | CGACGTGCTAACTTGCGTGA (F) | Calero-Caceres et al., 2014 | |
| GGCATTGTTGGAAACTTGCA (R) | |||
| FAM-AGTTCATTGAACAGGGTGA-BHQ-1 (Pb) | |||
| blaCTX-M-1 | ATGTGCAGCACCAGTAAAGTGATGGC (F) | Dungan et al., 2018 | |
| ATCACGCGGATCGCCCGGAAT (R) | |||
| HEX-CCCGACAGCTGGGAGACGAAACGT-BHQ-1 (Pb) |
qPCR reaction preparation
Thaw reagents and samples appropriately prior to use.
Gently vortex and spin down reagents and samples, except for the TaqPath Master Mix.
(Rather than vortex, the TaqPath should be gently mixed via pipette)
For each duplex, prepare the reactions as follows:
For purified nucleic acid samples, combine the following components in an optical reaction plate for each duplex:
| A | B | C | |
| Component | Volume (µl) | Final Concentration | |
| Nuclease-free Water | 5.9 | N/A | |
| Forward Primer 1 (20 µM) | 0.1 | 0.2 µM | |
| Reverse Primer 1 (20 µM) | 0.1 | 0.2 µM | |
| Probe 1 (10 µM) | 0.1 | 0.1 µM | |
| Forward Primer 2 (20 µM) | 0.1 | 0.2 µM | |
| Reverse Primer 2 (20 µM) | 0.1 | 0.2 µM | |
| Probe 2 (10 µM) | 0.1 | 0.1 µM | |
| TaqPath Master Mix (4x) | 2.5 | 1 unit/µL | |
| Nucleic acid sample | 1 | N/A |
Total reaction volume: 10 µL
For template controls, combine the following components in an optical reaction plate for each duplex:
| A | B | C | |
| Component | Volume (µl) | Final Concentration | |
| Nuclease-free Water | 5.9 | N/A | |
| Forward Primer 1 (20 µM) | 0.1 | 0.2 µM | |
| Reverse Primer 1 (20 µM) | 0.1 | 0.2 µM | |
| Probe 1 (10 µM) | 0.1 | 0.1 µM | |
| Forward Primer 2 (20 µM) | 0.1 | 0.2 µM | |
| Reverse Primer 2 (20 µM) | 0.1 | 0.2 µM | |
| Probe 2 (10 µM) | 0.1 | 0.1 µM | |
| TaqPath Master Mix (4x) | 2.5 | 1 unit/µL | |
| Template control 1 | 0.5 | N/A | |
| Template control 2 | 0.5 | N/A |
Total reaction volume: 10 µL
For non-template controls, combine the following components in an optical reaction plate for each duplex:
| A | B | C | |
| Component | Volume (µl) | Final Concentration | |
| Nuclease-free Water | 6.9 | N/A | |
| Forward Primer 1 (20 µM) | 0.1 | 0.2 µM | |
| Reverse Primer 1 (20 µM) | 0.1 | 0.2 µM | |
| Probe 1 (10 µM) | 0.1 | 0.1 µM | |
| Forward Primer 2 (20 µM) | 0.1 | 0.2 µM | |
| Reverse Primer 2 (20 µM) | 0.1 | 0.2 µM | |
| Probe 2 (10 µM) | 0.1 | 0.1 µM | |
| TaqPath Master Mix (4x) | 2.5 | 1 unit/µL |
Total reaction volume: 10 µL
Pipette up and down 10 times to mix, then spin down.
Incubate reactions in a real-time PCR machine under the following conditions:
| A | B | C | D | |
| Step | Temp | Duration | Cycles | |
| Initial Denaturation | 95 | 10 minutes | 1 | |
| Denaturation | 95 | 15 seconds | 40 | |
| Annealing/Extension | 60 | 1 minute | 40 |
Imaging step should follow the annealing/extension step
Template control info
ARG standard sequences for each target are described below:
| A | B | |
| Gene Target | Sequence | |
| ermB | TTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAGCCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCAGACTTGAGTGTGCAAGAGCAACCCTAGTGCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATCCTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAA | |
| tetB | TTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAGAATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGTTTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGAGTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGC | |
| blaKPC | TCGCCTGGGATGGCGGAGTTCAGCTCCAGCTCCCAGCGGTCCAGACGGAACGTGGTATCGCCGATAGAGCGCATGAAGGCCGTCAGCCCGGCCGGGCCGCCCAACTCCTTCAGCAACAAATTGGCGGCGGCGTTATCACTGTATTGCACGGCGGCCGCGGACAGCTCCGCCACCGTCATGCCTGTTGTCAGATATTTTTCCGAGATGGGTGACCACGGAACCAGCGCATTTTTGCCGTAACGGATGGGTGT | |
| blaSHV | CCTGGCGCGCCGATGAACGCTTTCCCATGATGAGCACCTTTAAAGTAGTGCTCTGCGGCGCAGTGCTGGCGCGGGTGGATGCCGGTGACGAACAGCTGGAGCGAAAGATCCACTCTATCGCCAGCAGGATCTGGTGGATACTCGCCGGTCAGCGAAAAACATCTTGCCGACGGCATGACGGTCGGCGAACTCTGTGCCGCCGCCATTACCATGAGCGATAACAGCGCCGCCAATCTGCTGCTGGCCACCGT | |
| QnrS | AACTTTTCACATAAAGACTTAAGTGATCTCACCTTCACCGCTTGCACATTCATTCGCAGCGACTTTCGACGTGCTAACTTGCGTGATACGACATTCGTCAACTGCAAGTTCATTGTCACCCTGTTCAATGAACTCTGCCACTTTGATGTCGCAGATCTTCGTGATGCAAGTTTCCAACAATGCCAACTTGCGATGGCAAACTTCAGTAATGCCAATTGCTACGGTATAGAGTTCCGTGCGTGTGATTTAA | |
| blaCTX-M-1 | GATGAGCGCTTTGCGATGTGCAGCACCAGTAAAGTGATGGCCGTGGCCGCGGTGCTGAAGAAAAGTGAAAGCGAACCGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCTGACTTGGTTAACTATAATCCGATTGCGGAAAAGCACGTCGATGGGACACGTTTCGTCTCCCAGCTGTCGGGGGCCGCGCTACAGTACAGCGATAACGTGGCGATGAATAAGCTGATTTCTCACGTTGGCGGCCCGGCTAGCGTCACCGCGTTCGCCCGACAGCTGGGAGACGAAACGTTCCGTCTCGACCGTACCGAGCCGACGTTAAACACCGCCATTCCGGGCGATCCGCGTGATACCACTTCACCTCGG |
See Table 1 for CARD accession numbers.