Jul 18, 2024

qPCR based multipathogen detection for SARS-CoV-2, CrAssphage and Hepatitis E virus from wastewater samples.

  • 1Wellcome Trust Research Laboratory, Christian Medical College, Vellore, India;
  • 2Department of Community Health, Christian Medical College, Vellore, India
Icon indicating open access to content
QR code linking to this content
Protocol CitationDilip Abraham, Blossom Benny, Nirmal Kumar, Karthikeyan Govindan, Venkata Raghava Mohan 2024. qPCR based multipathogen detection for SARS-CoV-2, CrAssphage and Hepatitis E virus from wastewater samples. . protocols.io https://dx.doi.org/10.17504/protocols.io.n92ld8787v5b/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 11, 2024
Last Modified: July 18, 2024
Protocol  Integer ID: 103283
Keywords: Severe Acute Respiratory Syndrome Coronavirus 2(SARS CoV2), Hepatitis E virus (HEV), detecting multiple viral gene target, qpcr assay, multiple viral gene targets for the pathogens sar, target viral rna, multipathogen detection for sar, viral rna, detect sar, wastewater sample, based multipathogen detection, pathogens sar, qpcr, wastewater, total nucleic acid, rna, target detection
Funders Acknowledgements:
Bill & Melinda Gates Foundation
Grant ID: INV-049093
Abstract
This protocol outlines the steps for detecting multiple viral gene targets for the pathogens SARS-CoV-2, CrAssphage and HEV using a qPCR assay. Total Nucleic Acid (TNA) extracted from environmental samples (wastewater) is used for testing.

Key Steps and Considerations:
  1. qPCR Amplification Cycles:
  • Follow the outlined cycling conditions for optimal amplification of target viral RNA.
2. Target Detection:
  • Detect SARS-CoV-2 and HEV using specific primers and probes designed for these targets.

Guidelines
This protocol describes qPCR based detection of SARS-CoV-2 and HEV gene targets. Additionally, CrAssphage, an indicator of human fecal contamination, and MS2, serving as an external control, are included in the qPCR assays. Due to the similarity in cycling conditions, these assays can be conducted simultaneously for a sample as two distinct panels.

The positive controls (PCs) used here are linear oligos (gBlocks) that have been used in generating standard curves. Ideally the concentration of PCs used should yield Ct values that fall in the linear phase of the amplification curve.

Materials
  1. QuantStudio 7 Flex Real-Time PCR System OR QuantStudioTM 12K Flex Real-Time PCR System
  2. AgPath-ID™ One-Step RT-PCR ReagentsThermo FisherCatalog #4387391
  3. RNA MS2 from Bacteriophage MS2RocheCatalog #10165948001
  4. Nuclease-free water AmbionCatalog #AM9932
  5. gBlock gene fragmentsIDT (sequence described in protocol)
  6. Primers and Probes (Sigma/Thermo Fisher) (detailed in protocol)
  7. MicroAmp Optical 96-Well Reaction Plate with Barcode Thermofisher Catalog #4306737
  8. MicroAmp Optical Adhesive Film Thermofisher Catalog # 4311971
  9. 1.7 mL MaxyClear Snaplock Microcentrifuge Tube Axygen Catalog #MCT-175-C
  10. Finnpipette F1 100 to 1000 μL Thermo Fisher Catalog #4641100N
  11. Finnpipette F1 20 to 200 μL Thermo Fisher Catalog #4641080N
  12. Finnpipette F1 2 to 20 μL Thermo Fisher Catalog #4641060N
  13. Finnpipette F1 0.2 to 2 μL Thermo Fisher Catalog #4641010N
  14. ART Barrier Specialty Pipette tips 1000 μL Thermo Fisher Catalog #2279-05PK
  15. ART Barrier Specialty Pipette tips 200 μL Thermo Fisher Catalog #2069-05PK
  16. ART Barrier Specialty Pipette tips 20 μL Thermo Fisher Catalog #2149P-05PK
  17. ART Barrier Specialty Pipette tips 10 μL Thermo Fisher Catalog #2139-05PK
  18. Microplate Centrifuge, PCR Plate Spinner VWR Catalog #VWRU89184-610


Before start
Fluorescent Dye Selection:
  • Ensure the chosen fluorescent dyes are compatible with the qPCR machine being used.
  • If using different dyes than those specified in the protocol, verify their excitation/emission spectra to prevent overlap and avoid crossover between targets.
  • Calibration of the qPCR machine may be necessary if using alternative fluorescent dyes to ensure accurate detection and measurement.
Primer-Probe Panel
The following primers and probes are employed for the detection of SARS-CoV-2, CrAssphage and HEV gene targets.
The following set of primer-probes are used for the detection of SARS-CoV2 and CrAssphage gene targets.

ABC
TARGET PRIMERSSEQUENCES 5' TO 3'
SARS-CoV-2 N1ForwardGACCCCAAAATCAGCGAAAT
ReverseTCTGGTTACTGCCAGTTGAATCTG
Probe[JOE]-ACCCCGCATTACGTTTGGTGGACC-[BHQ1]
SARS-CoV-2 -N2 ForwardTTACAAACATTGGCCGCAAA
ReverseGCGCGACATTCCGAAGAA
Probe[TAMRA]-ACAATTTGCCCCCAGCGCTTCAG-[BHQ2]
CrAssphageForwardCAGAAGTACAAACTCCTAAAAAACGTAGAG
ReverseGATGACCAATAAACAAGCCATTAGC
Probe[FAM]-AATAACGATTTACGTGATGTAAC-[MGB]
Table 1: Primers and Probes for SARS-CoV-2 and CrAssphage. Fluorescent dyes and quenchers are shown in square brackets.


The following set of primer-probes are used for the detection of HEV and MS2 targets.


ABC
TARGETPRIMERSSEQUENCES 5' TO 3'
HEVForwardGGTGGTTTCTGGGGTGAC
ReverseAGGGGTTGGTTGGATGAA
Probe[FAM]-TGATTCTCAGCCCTTCGC-[MGB]
MS2ForwardTGGCACTACCCCTCTCCGTATTCAC
ReverseGTACGGGCGACCCCACGATGAC
Probe[TAMRA]-CACATCGATAGATCAAGGTGCC-[BHQ2]
Table 2: Primers and Probes for HEV and MS2. Fluorescent dyes and quenchers are shown in square brackets.


Primer-Probe Reconstitution
To reconstitute the lyophilized primers/probes use the nmole information on the specification sheet received with the primers and probes.
Multiply nmole value by 10 to get the required volume of Nuclease Free Water (NFW) needed to reconstitute the lyophilized primer/probes.
e.g. For a primer with 30 nmoles, to make 100 micromolar (µM) stock solution: 30nmol x 10 = 300 µL of NFW (Nuclease free water) to make 100 micromolar (µM) stock solution.
Add the required volume of NFW, pulse vortex and spin down. This is the primer / probe stock with 100 micromolar (µM) concentration.
Store at -20 °C for long term storage.

Primer-Probe Dilution
Using the 100 micromolar (µM) stock, prepare a 20 micromolar (µM) working stock for each primer/probe.
In a fresh tube add 20 µL of 100 micromolar (µM) primer stock and 80 µL of NFW to make 100 µL of 20 micromolar (µM) working primer/probe.
Store at 4 °C for frequent usage or -20 °C for long term storage.

qPCR Controls
Controls to be used when performing qPCR assay.
Positive control: gBlocks gene fragments corresponding to each gene target is included in
PCR panels to use as positive control in pre-defined concentrations.


gBLOCK GeneSequencebp size
SARS-CoV-2 N1TTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACT 171
SARS-CoV-2 N2TGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCT ACACAGGTGCCATCAAATTG 161
HEVGGTGGTTTCTGGGGTGACCGGGTTGATTCTCAGCCCTTCGCAATCCCCTATATTCATCCAACCAACCCCT 70
CrAssphageCAGAAGTACAAACTCCTAAAAAACGTAGAGGTAGAGGTATTAATAACGATTTACGTGATGTAACTCGTAAAAAGTTTGATGAACGTACTGATTGTAATAAAGCTAATGGCTTGTTTATTGGTCATC126
Table 3: Sequences used for gBlocks gene fragments. Sequences for the targets SARS-CoV-2 N1 and N2 is taken from SARS-CoV-2 reference genome NC_045512.2) and the HEV sequence is taken from the HEV virus complete genome sequence(MN401238.1). CrAssphage reference genome (MK415410.1).

Negative control: 3 µL of extraction blank of each batch of extraction.
NTC: Master mix alone used for no template control.

Preparation of PCR reaction mix
Thaw qPCR reagents and samples on ice and briefly spin it down. Do not vortex the AgPath master mix, mix by flicking or pipetting.
SARS-CoV-2/CrAssphage panel

Prepare the master mix as follows for the number of samples, positive and negative controls, NTC and one extra reaction to account for any pipetting error.

Reagentsvolume (x1) ul
Ag Path master mix10
25x Enzyme mix0.8
N1 F primer0.25
N2 R primer0.25
N1 probe0.125
N2 F primer0.25
N2 R primer0.25
N2 probe0.125
CPQ F primer0.25
CPQ R primer0.25
CPQ probe0.125
NFW4.325
Table 4: SARS-CoV-2/CrAssphage - PCR reaction mix

Hepatitis-E Virus (HEV) and MS2 bacteriophage panel

Prepare the master mix as follows for the number of samples, positive and negative controls, NTC and one extra reaction to account for any pipetting error.

Reagentsvolume (x1) ul
Ag Path master mix10
25x Enzyme mix0.8
HEV F primer0.25
HEV R primer0.25
HEV probe0.125
MS2 F primer0.25
MS2 R primer0.25
MS2 probe 0.125
NFW4.95
Table 5: HEV/MS2 PCR reaction mix
HEV and MS2 PCR- Total volume of master mix to add will be 17 µL
Dispense 17 µL of master mix per reaction into the wells of a standard 96-well PCR plate on ice.
Add 3 µL of sample TNA (Total Nucleic Acid). Mix well my pipetting.
Seal the plate with a roller sealer and then centrifuge the plate for 1 min at 2000g.
Load the plate into the Quantstudio7 flex instrument after properly starting it up. Open QS7 software, then select - "New experiment set up".
Set up the experiment properties with 96-well block, TaqMan reagents,0.2ml PCR plate and
standard run. Define sample ID and define the targets as described for respective PCR panels.
Assign targets and sample ID to each well.
Thermocycler conditions/ program
Set up the real time PCR conditions as follows:

Step Temperature in CelsiusTime
Reverse Transcription45° C20 min
PCR initial heat activation 95° C10 min
2-step cycling (40 cycles)
Denaturation95° C15 sec
Combined annealing/extension55° C (data collection step)1 min

Click - "Run" to start the qPCR.
Once the run is complete, adjust the thresholds and baseline if any abnormal baseline at the start or at the end is observed, which may lead to a false-positive curve. Verify if the PC is within the range using defined Ct values chosen from running the standards.
Export the result to excel/csv file. Upload both run and csv files to Dropbox/OneDrive for backup.
The threshold for each target can be set such that the PC for that target falls within the pre-defined range obtained with the standard curves.

The sample is considered positive if the amplification curve is appropriate and the Ct value falls below the defined cut-off thresholds for each target.

A separate protocol, provided in the Typhoid ES workspace, serves as an example and can be followed to generate Ct cut-off values:


Protocol
CREATED BY
Jonathan Rigby



Protocol references
1. Wozniak, A., Cerda, A., Ibarra-Henríquez, C. et al. A simple RNA preparation method for SARS-CoV-2 detection by RT-qPCR. Sci Rep 10, 16608 (2020). https://doi.org/10.1038/s41598-020-73616-w
2. https ://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel -prime r-probes.
3. Ahmed W, Payyappat S, Cassidy M, Besley C. A duplex PCR assay for the simultaneous quantification of Bacteroides HF183 and crAssphage CPQ_056 marker genes in untreated sewage and stormwater. Environment International. 2019 May;126:252-259. DOI: 10.1016/j.envint.2019.01.035.
4. Jothikumar N, Cromeans TL, Robertson BH, Meng XJ, Hill VR. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J Virol Methods. 2006 Jan;131(1):65-71. doi: 10.1016/j.jviromet.2005.07.004.
5. Liu J, Kibiki G, Maro V, Maro A, Kumburu H, Swai N, Taniuchi M, Gratz J, Toney D, Kang G, Houpt E. Multiplex reverse transcription PCR Luminex assay for detection and quantitation of viral agents of gastroenteritis. J Clin Virol. 2011 Apr;50(4):308-13. doi: 10.1016/j.jcv.2010.12.009.