Mar 03, 2024

Public workspaceqPCR assay for Aquarickettsia spp. V.2

  • Sterling Butler1,
  • Stephanie Rosales1
  • 1UM NOAA
  • Vega Thurber Lab
  • AOML
Icon indicating open access to content
QR code linking to this content
Protocol CitationSterling Butler, Stephanie Rosales 2024. qPCR assay for Aquarickettsia spp.. protocols.io https://dx.doi.org/10.17504/protocols.io.14egn2n6pg5d/v2Version created by Ana M Palacio-Castro
Manuscript citation:
J Grace Klinges, Shalvi H Patel, William C Duke, Erinn M Muller, Rebecca L Vega Thurber, Phosphate enrichment induces increased dominance of the parasiteAquarickettsiain the coralAcropora cervicornis,FEMS Microbiology Ecology, Volume 98, Issue 2, February 2022, fiac013,https://doi.org/10.1093/femsec/fiac013

Palacio-Castro, A.M., Dennison, C.E., Rosales, S.M.et al.Variation in susceptibility among three Caribbean coral species and their algal symbionts indicates the threatened staghorn coral,Acropora cervicornis,is particularly susceptible to elevated nutrients and heat stress.Coral Reefs40, 1601–1613 (2021). https://doi.org/10.1007/s00338-021-02159-x
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 17, 2023
Last Modified: March 03, 2024
Protocol Integer ID: 77144
Keywords: aquarickettsia spp, qpcr for the quantification, qpcr, putative parasite
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
qPCR for the quantification of Aquarickettsia spp. (Klinges et al., 2022) a putative parasite found in the coral A. cervicornis. This protocol has been altered by incorporating a recently published A. cervicornis CAM control gene (Palacio-Castro et al., 2021) targeted to detect differences across A. cervicornis genotypes because it is a single-copy gene in A. cervicornis.
Guidelines
  • PrimeTime MM - (keep in -20 for long storage)
  • Forward coral host primer (Acropora) at 10 uM (keep in -20 for long storage) - Primer sequences from https://doi.org/10.1007/s00338-021-02159-x
  • Reverse coral host primer (Acropora) at 10 uM (keep in -20 for long storage) - Primer sequences from https://doi.org/10.1007/s00338-021-02159-x
  • Forward Aquarickettsia primer at 10 uM (keep in -20 for long storage) - Primer sequences from
  • Reverse Aquarickettsia primer at 10 uM (keep in -20 for long storage) - Primer sequences from
Materials
Reagents

  1. Primers of tlc1 gene of A. rohwerii
  • 10 μM Forward : 5′ - AGGAGTTTGGAAAGCACAAG - 3′,
  • 10 μM Reverse : 5′ - GCTACCAAATAACATAGCAGAC - 3′
  • 10 μM Probe : TGCAAACTTATACTGGCCTTGCAAGT

2. Primers of Calmodulin (CaM) in the Caribbean Acropora spp. (adpated from https://doi.org/10.1007/s00338-021-02159-x)
  • 10 μM forward: 5’ - GGTTATTTACAAGCCCAACCAAG - 3’,
  • 10 μM Reverse: 5’ - ACAGAAGGGCCACTGAAATAG - 3’
  • 10 μM Probe : ACTCCAGATTTCAAGTCTGATGCCCT

3. PrimeTime Gene Expression Master MIx (IDT 1055770)
4. DNase/RNase free water/PCR grade water
5. Optical 8-cap strips for  0.2 ml tubes (Biorad TCS0803)
6. white PCR Plate (Biorad MLL9651)
7. Sterile 1.5 mL screw-top microcentrifuge tubes
8. Sterile filter pipette tips



Equipment
  • Quantitative PCR instrument
  • Microcentrifuge and/or reagent reservoir
  • Vortex
  • Laminar flow hood for PCR setup
Troubleshooting
Prepare for qPCR
  • Remove PCR reagents from freezer and allow reagents to thaw on ice or at room temperature.
  • Wipe down PCR hood with 10% bleach and ethanol.
  • Place consumables such as tubes, plates, plate sealers, and water in PCR hood and turn on UV light for Duration00:20:00
  • Once everything is thawed vortex PCR reagents, spin them down, and place them on ice.
  • Keep reagents cool or on ice during the duration of the protocol.

20m
Prepare PCR master mix
Prepare enough master mix for the number of reactions needed. Each combination of sample and target (gene) should be run at least in duplicates. Add a few reactions to your calculations to account for pipetting errors.

A. cervicornis (CAM) master mix


ABC
Component Volume per Rxnx rxn + 10%
PCR water2.4 uL
PrimeTime MM 5 uL
Forward primer (10 uM)0.2 uL
Reverse primer (10 uM)0.2 uL
Probe (10 uM)0.2 uL
Total MM volume per reaction8 uL



A. rohwerii (tlc1) master mix
ABC
Component Volume per Rxnx rxn + 10%
PCR water2.4 uL
PrimeTime MM5 uL
Forward primer (10 uM)0.2 uL
Reverse primer (10 uM)0.2 uL
Probe (10 uM)0.2 uL
Total MM volume per reaction8 uL
  • Combine all the PCR master-mix reagents in a microcentrifuge tube
  • Mix gently and spin down to collect mixture and remove bubbles
Setup the qPCR plate
  • Add 8 uL of master mix to each well. Aiming for the bottom of the well will help to visualize what wells had master mix and DNA added.
  • Add DNA to each well (2 uL). Aiming for the top of the well will help to visualize what wells had master mix and DNA added.
  • Close the plate with optical clear caps or seals
  • Spin down the plate to mix the DNA and mastermix.
  • Place in the qPCR machine and start the machine using the specified settings.
qPCR thermocyler program settings
Select SYBER green and long run
ABCD
Procedure TemperatureTime Cycle
Initial denaturation95 C3 min1
Denaturation95 C15 sec40
Annealing60 C1 min40
Extension72 C30 sec40