Nov 28, 2025
Protocol for SPLiT-seq
- Ashley Robbins1
- 1University of Pennsylvania
Protocol Citation: Ashley Robbins 2025. Protocol for SPLiT-seq . protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l27o8jg1y/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 18, 2022
Last Modified: November 28, 2025
Protocol Integer ID: 71491
Keywords: single-cell sequencing, seq library preparation, protocol for split, seq, library preparation, split, protocol
Abstract
Protocol for SPLiT-seq library preparation from Robbins et al. 2025
Materials
Materials List:
SPLiTseq_MaterialsList.xlsx Oligonucleotides to order from IDT:
96 well barcode plates
- All plates were ordered from IDT with the following specifications:
- 100 nmole DNA Plate Oligo (96 Well)
- Purification: Standard Desalting
- Plate Type: Deep Well
- Normalized Yield: 14 nmol
- Number of Additional Replicates: 1
Round 1 Barcodes (96 barcodes, polydT only):
Round1_oligos.xlsx Round 2 Barcodes (96 barcodes):
Round2_oligos.xlsx Round 3 Barcodes (96 barcodes):
Round3_oligo.xlsx TruSeq Index Primers (1 universal 5' index + 24 3' indices):
SPLiTseq_TruSeqIndices_v2.xlsx Additional oligos/primers:
| A | B | C | |
| BC_0108 | PCR Forward Primer | AAGCAGTGGTATCAACGCAGAGT | |
| BC_0062 | PCR Reverse Primer | CAGACGTGTGCTCTTCCGATCT | |
| BC_0215 | Round 2 barcode linker | CGAATGCTCTGGCCTCTCAAGCACGTGGAT | |
| BC_0216 | Round 2 blocking strand | ATCCACGTGCTTGAGAGGCCAGAGCATTCG | |
| BC_0060 | Round 3 barcode linker | AGTCGTACGCCGATGCGAAACATCGGCCAC | |
| BC_0066 | Round 3 blocking strand | GTGGCCGATGTTTCGCATCGGCGTACGACT | |
| BC_0217 | Template switching primer, HPLC purified | AAGCAGTGGTATCAACGCAGAGTGAATrGrG+G | |
| BC_0243 | Adapter duplex 1 | ACACTCTTTCCCTACACGACGCTCTTCCGATC*T | |
| BC_0244 | Adapter duplex 2 | GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
*phosphorothioate bond
Troubleshooting
Starting Notes
This protocol is best split into a 3 day process:
Day 1: Sections 1-6
Day 2: Sections 7-9
Day 3: Sections 10-11
1. Barcode Plate Generation
Briefly spin down the IDT 96-well barcode plates prior to re-suspension.
Dilute the IDT 96-well barcode stock plates to 100 uM with RNase-free, DNase-free H2O.
Dilute the barcode linker oligos (BC_0215 & BC_0600) to 1 mM with RNase-free, DNase-free H2O.
Prepare Round 1 Barcode Plates:
Using a multichannel P100 pipette, transfer 25 µL of Round 1 barcode oligos from the IDT 96-well barcode stock plate to each corresponding wells of a 96-well LoBind PCR plate.
Add 75 µL of RNase-free, DNase-free H2O to each well of the 96-well LoBind PCR plate. Mix thoroughly.
Aliquot 25 µL into (3) 96-well LoBind PCR plates. Store at -20°C until use.
Prepare Round 2 Barcode Plates:
Using a multichannel P100 pipette, transfer 12 µL of Round 2 barcode oligos from the IDT 96-well barcode stock plate to each corresponding wells of a 96-well LoBind PCR plate.
Add 138.6 µL of BC_0215 (1mM) to 10.9494 mL of RNase-free, DNase-free H2O to a sterile pipette basin. Mix thoroughly.
Using a multichannel P100 pipette, transfer 88 µL of the diluted BC_0215 from the basin to the 96-well LoBind PCR plate. Mix thoroughly.
To anneal the barcode and oligo linkers, incubate in a thermocycler with the following protocol:
- 95 °C for00:02:00
- 20 °C at a rate of -0.1C/s
- Hold at 4 °C
2m
Aliquot 10 µL into (6) 96-well LoBind PCR plates. Store at -20°C until use.
Prepare Round 3 Barcode Plates:
Using a multichannel P100 pipette, transfer 12 µL of Round 3 barcode oligos from the IDT 96-well barcode stock plate to each corresponding wells of a 96-well LoBind PCR plate.
Add 163.8 µL of BC_0060 (1mM) to 10.6722 mL of RNase-free, DNase-free H2O to a sterile pipette basin. Mix thoroughly.
Using a multichannel P100 pipette, transfer 86 µL of the diluted BC_0060 from the basin to the 96-well LoBind PCR plate. Mix thoroughly.
To anneal the barcode and oligo linkers, incubate in a thermocycler with the following protocol:
- 95 °C for00:02:00
- 20 °C at a rate of -0.1C/s
- Hold at 4 °C
2m
Aliquot 10 µL into (6) 96-well LoBind PCR plates. Store at -20°C until use.
2. Nuclei Counting and Loading
Thaw fixed cells/nuclei samples in a 37°C water bath. Once samples are fully thawed, transfer to an ice bucket.
Aliquot 5 uL of each sample into 200uL eppendorf tubes or 8-strip PCR tubes.
Add 10 uL of 15 ug/mL DAPI in PBS to dilute the samples 1:3.
Count on hemocytometer with DAPI fluorescence on EVOS.
Dilute nuclei suspensions to 300-1,250 nuclei per uL.
3. Round 1: Reverse Transcription
Thaw the Round 1 Barcode plate at RT. Centrifuge briefly.
5m
Aliquot 4 µL of the R1 barcodes into a 96-well LoBind PCR plate with a P10 multichannel pipette.
Prepare Reverse Transcription mix on ice:
| A | B | C | D | E | |
| Reagent | Stock Concentration | Desired Concentration | Per Reaction (uL) | Volume in Mix (uL) (96 wells + 10%) | |
| 5X RT Buffer | 5X | 1X | 4 | 422.4 | |
| RNaseOUT | 40 U/uL | 0.25 U/uL | 0.125 | 13.2 | |
| SUPERase•In | 20 U/uL | 0.25 U/uL | 0.25 | 26.4 | |
| dNTPs | 10 mM | 500 µM | 1 | 105.6 | |
| Maxima H Minus Reverse Transcriptase | 200 U/uL | 20 U/uL | 2 | 211.2 | |
| H2O | N/A | N/A | 0.625 | 66 | |
| Total Volume | 8 | 844.8 |
5m
Add 8 µL of the RT mix to each well of the 96-well plate. Total volume = 12 uL/well.
5m
Add 8 µL of nuclei suspension into each well of the 96-well plate, mix up and down 2-3X to ensure the nuclei are resuspended. Total volume = 20 uL/well
In total, load 2,400 to 10,000 nuclei per well.
15m
Place the plate in the thermocycler and run the following protocol for reverse transcription:
| A | B | C | |
| Step | Time | Temperature | |
| 1 | 10 min. | 50° | |
| Begin Cycling | |||
| 2 | 12 sec. | 8°C | |
| 3 | 45 sec. | 15°C | |
| 4 | 45 sec. | 20°C | |
| 5 | 30 sec. | 30°C | |
| 6 | 2 min. | 42°C | |
| 7 | 3 min. | 50°C | |
| 8 | Go to Step 2, repeat 2X | ||
| 9 | 5 min. | 50°C | |
| 10 | HOLD | 4°C |
Lid Temperature: 70°C; Sample Volume: 20 uL
40m
Immediately place the 96-well plate on ice.
Prepare 2 mL of 1X NEB buffer 3.1 with 20 µL RNaseOUT RNase inhibitor.
Transfer the sample from each well into a 15 mL conical tube, making sure to wash the sides of each well twice to retain nuclei.
Add9.6 µL of 10% Triton X-100 (final conc. 0.1%) to the nuclei suspension.
Centrifuge at RT for 00:10:00 at 500 x g in a swinging bucket rotator.
10m
Carefully aspirate the supernatant as to not disturb the nuclei pellet.
Re-suspend in 2 mL of 1X NEB buffer 3.1 + RNase Inhibitor from Step 12.
4. Round 2: Ligation Barcoding
Prepare Round 2 ligation mix on ice:
| A | B | C | D | |
| Reagent | Stock Conc. | Final Conc. | Volume (uL) | |
| H2O | N/A | N/A | 1337.5 | |
| T4 Ligase Buffer | 10X | 1X | 500 | |
| RNaseOUT | 40 U/uL | 0.32 U/uL | 40 | |
| SUPERase•In | 20 U/uL | 0.05 U/uL | 12.5 | |
| rAlbumin | 20 mg/mL | 0.2 mg/mL | 50 | |
| T4 DNA Ligase | 400 U/uL | 8 U/uL | 100 | |
| Total Volume: | 2040 |
Add the 2 mL nuclei suspension from Step 17 to the ligation mix. Total volume: 4.04 mL
Add nuclei:ligation mix to a sterile pipette basin.
With a P50 multichannel pipet, add 40 µL of the nuclei:ligation mix to each well of the 96-well R2 Ligation Plate.
Cover the plate with an adhesive seal and incubate for 00:30:00 at37 °C in a pre-heated thermocycler.
30m
Prepare the Round 2 blocking solution and add to a sterile pipette basin.
| A | B | C | D | |
| Reagent | Stock Conc. | Final Conc. | Volume (uL) | |
| BC_0216 | 100 µM | 26.4 µM | 316.8 | |
| T4 Ligase Buffer | 10X | 2.5X | 300 | |
| H2O | N/A | N/A | 583.2 | |
| Total Volume: | 1200 |
Remove the Round 2 Ligation Plate from the incubator and remove the adhesive seal.
Using a P20 multichannel pipet, add 10 uL of the Round 2 blocking solution to each well. Total volume: 60 uL/well
Cover the plate with an adhesive seal and incubate for 00:30:00 at37 °C in a pre-heated thermocycler.
30m
5. Round 3: Ligation Barcoding
Remove the Round 2 Ligation Plate from the incubator and pool the nuclei from each well into a sterile pipette basin with a P200 multichannel pipet.
Pass the pooled nuclei suspension through a 40 µM cell strainer into a new basin.
Add 100 µL of T4 DNA Ligase to the nuclei suspension (in the basin) and mix by pipetting ~20X.
With a P200 multichannel pipet, add 50 µL of the nuclei suspension (+ ligase) to each well of the Round 3 Ligation Plate.
Cover the plate with an adhesive seal and incubate for 00:30:00 at37 °C in a pre-heated thermocycler.
30m
Prepare the Round 3 blocking and termination solution and add to a sterile pipette basin:
| A | B | C | D | |
| Reagent | Stock Conc. | Final Conc. | Volume (uL) | |
| BC_0066 | 100 µM | 11.5 µM | 369 | |
| EDTA | 0.5 M | 125 mM | 800 | |
| H2O | N/A | N/A | 2031 | |
| Total Volume: | 3200 |
Remove the Round 3 Ligation Plate from the incubator and remove the adhesive seal.
With a P50 multichannel pipet, add 20 µL of the Round 3 blocking and termination solution to each well of the plate.
Pool the nuclei from each well into a sterile pipette basin with a P200 multichannel pipet.
Pass the pooled nuclei suspension through a 40 µM cell strainer into 15 mL conical tube.
6. Nuclei Sub-library Lysis
Prepare 2X lysis buffer:
| A | B | C | D | |
| Reagent | Stock Conc. | Final Conc. | Volume (mL) | |
| Tris, pH 8.0 | 1 M | 10 mM | 0.5 | |
| NaCl | 5 M | 400 mM | 2 | |
| EDTA, pH 8.0 | 0.5 M | 100 mM | 5 | |
| SDS | 10% | 4.4% | 11 | |
| H2O | N/A | N/A | 6.5 | |
| Total Volume: | 25 |
Incubate the 2X lysis buffer at 37 °C for 00:10:00 (or until the solution is clear and there is no precipitate present).
10m
Prepare the wash buffer:
4 mL 1X PBS
40 µL 10% Triton X-100
10 µL SUPERase•In RNase Inhibitor
Add 70 µL of 10% Triton X-100 to the nuclei suspension.
Centrifuge at RT for 00:10:00 at 600 x g in a swinging bucket rotator.
10m
Remove the supernatant with a P1000 pipet, being careful not to disturb the pellet.
You may leave ~20-30 uL in favor of preserving the pellet, using a P20 pipet to remove as much supernatant as possible.
Add 1 mL of wash buffer to the nuclei pellet, allow to sit on ice for 00:02:00
2m
Re-suspend the nuclei pellet and add an additional 3 mL of wash buffer.
Centrifuge at RT for 00:10:00 at 600 x g in a swinging bucket rotator.
10m
Remove the supernatant with a P1000 pipet, being careful not to disturb the pellet.
Add 50 uL of 1X PBS + RNase inhibitor to the nuclei pellet, let sit on ice for 2 min. prior to re-suspension.
Dilute 5 uL of the nuclei suspension in 15 uL of 1X PBS + DAPI. Count on a hemocytometer.
Add X uL of nuclei to 8-strip PCR tubes and bring volume to 25 uL with PBS + RNase inhibitor.
Add 25 uL of 2X lysis buffer to each tube.
Add 5 uL of Proteinase K (20mg/mL) to each tube. Total volume: 30 uL
Incubate in a thermocycler with the following protocol:
| A | B | C | |
| Step | Time | Temperature | |
| 1 | 120 min. | 55°C | |
| 2 | HOLD | 4°C |
Lid Temperature: 80°C; Sample Volume: 55 uL
Freeze lysates at 80°C and store for up to 6 months.
7. cDNA Bead Purification
Make stock solutions of bead wash buffers (can be made ahead of time and stored at 4°C):
2X B&W Stock Solution:
| A | B | |
| Reagents | Volume | |
| 1M Tris-HCl pH 8.0 | 500uL | |
| 5M NaCl | 20ml | |
| EDTA, 0.5M | 100ul | |
| Nuclease Free Water | 29.4ml | |
| Total | 50mL |
1X B&W-T Stock Solution:
| A | B | |
| Reagents | Volume | |
| 1M Tris-HCl pH 8.0 | 100uL | |
| 5M NaCl | 4ml | |
| EDTA, 0.5M | 20ul | |
| Tween 20 10% | 100ul | |
| Nuclease Free Water | 15.78ml | |
| Total | 20mL |
Prepare working solutions on ice, adding RNase inhibitors:
1X B&W-T + RNase Inhibitors
| A | B | C | D | E | F | G | |
| Sample #: | 2 | 4 | 6 | 8 | 10 | 12 | |
| Reagent | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | |
| 1xB&W-T | 3600 | 4200 | 4800 | 5400 | 6000 | 6600 | |
| SUPERase In | 5 | 5.8 | 6.7 | 7.5 | 8.3 | 9.2 | |
| Total Volume: | 3605 | 4205.8 | 4806.7 | 5407.5 | 6008.3 | 6609.2 |
2X B&W + RNase Inhibitors
| A | B | C | D | E | F | G | |
| Sample #: | 2 | 4 | 6 | 8 | 10 | 12 | |
| Reagent | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | |
| 2X B&W | 110 | 220 | 330 | 440 | 550 | 660 | |
| SUPERase In | 2 | 4 | 6 | 8 | 10 | 12 | |
| Total Volume: | 112 | 224 | 336 | 448 | 560 | 672 |
Tris-T + RNase Inhibitors
| A | B | C | D | E | F | G | |
| Sample #: | 2 | 4 | 6 | 8 | 10 | 12 | |
| Reagent | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | |
| 10mM Tris-HCl, pH 8.0 | 600 | 1200 | 1800 | 2400 | 3000 | 3600 | |
| Tween-20 (10%) | 6 | 12 | 18 | 24 | 30 | 36 | |
| SUPERase In | 1.5 | 3 | 4.5 | 6 | 7.5 | 9 | |
| Total Volume: | 607.5 | 1215 | 1822.5 | 2430 | 3037.5 | 3645 |
For each sublibrary add 22 uL of Dynabeads™ MyOne™ Streptavidin C1 beads to a 1.5 mL LoBind Eppendorf tube (2 sublibraries = 44uL, 4 sublibraries = 88uL, etc.)
Add 100 uL of 1X B&W + RI buffer to the beads per sublibrary ( 2 sublibraries = 200uL, 4 sublibraries = 400uL, etc.)
Place sample against a magnetic rack and wait until liquid becomes clear (1-2 min).
Remove supernatant and repeat steps 58-60 twice for a total of 3 washes.
Re-suspend the beads in 55 uL of 2X B&W + RI buffer per sublibrary(2 sublibraries = 110uL, 4 sublibraries = 220uL, etc.).
Leave the beads in 2X B&W + RI buffer on ice.
Remove sublibraries from the -80°C and incubate at 37°C for 5-10 minutes (until there is no precipitate present).
Add 2.5 uL of 25X cOmplete™ Protease Inhibitor Cocktail to each sublibrary. Gently vortex to mix sample and spin down.
Incubate at RT for 10 min.
Add 50 uL of beads in 2X B&W + RI buffer to each sublibrary.
Incubate the sublibraries for 60 min with gentle agitation (~600 RPM) on a plate shaker to allow the beads to bind the cDNA.
Place the tubes against a magnetic rack and wait until liquid becomes clear (1-2 min).
Remove the supernatant and re-suspend the beads in 125 uL of 1X B&W + RI buffer.
Incubate the sublibraries for 1-2 min. at RT.
and repeat once for a total of 2 washes.
Place the tubes against a magnetic rack and wait until liquid becomes clear (1-2 min).
Remove the supernatant and re-suspend the beads in 125 uL of 10 mM Tris-T + RI buffer.
Incubate the sublibraries for 1-2 min. at RT.
Briefly spin down the sublibraries and place on ice.
8. Template Switching
Prepare the TSO mix on ice:
| A | B | C | D | E | F | G | |
| Sample #: | 2 | 4 | 6 | 8 | 10 | 12 | |
| Reagent | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | |
| Water | 88 | 176 | 264 | 352 | 440 | 528 | |
| Maxima RT Buffer | 44 | 88 | 132 | 176 | 220 | 264 | |
| Ficoll PM-400 (20%) | 44 | 88 | 132 | 176 | 220 | 264 | |
| 10mM dNTPs (each, total is 40mM) | 22 | 44 | 66 | 88 | 110 | 132 | |
| RNase Inhibitor | 5.5 | 11 | 16.5 | 22 | 27.5 | 33 | |
| TSO (BC_0127) | 5.5 | 11 | 16.5 | 22 | 27.5 | 33 | |
| Maxima RT RnaseH Minus Enzyme | 11 | 22 | 33 | 44 | 55 | 66 | |
| Total Volume: | 220 | 440 | 660 | 880 | 1100 | 1320 |
Place the tubes against a magnetic rack and wait until liquid becomes clear (1-2 min).
With the beads still on the magnetic rack, remove the supernatant and wash with 125 uL of UltraPure H2O.
DO NOT RE-SUSPEND THE BEADS!
Re-suspend the beads in 100 uL of TSO mix.
Incubate at RT for 30 min.
With a P200 pipet mix the samples 5X to re-suspend. Spin down briefly.
Incubate at 42°C for 90 min in a thermocycler, lid set to 70°C.
(OPTIONAL) If stopping prior to cDNA Amplification:
Place the tubes against a magnetic rack and wait until liquid becomes clear (1-2 min).
Remove the supernatant and re-suspend the beads in 125 uL of 10 mM Tris-T + RI buffer.
Store sublibraries overnight at 4°C.
9. cDNA Amplification
Prepare the following PCR mix on ice:
| A | B | C | D | E | F | G | |
| Sample #: | 2 | 4 | 6 | 8 | 10 | 12 | |
| Reagent | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | Volume (uL) | |
| Kapa Hifi 2x Master Mix | 121 | 242 | 363 | 484 | 605 | 726 | |
| BC_0108 (10uM) | 9.68 | 19.36 | 29.04 | 38.72 | 48.4 | 58.08 | |
| BC_0062 (10uM) | 9.68 | 19.36 | 29.04 | 38.72 | 48.4 | 58.08 | |
| Water | 101.64 | 203.28 | 304.92 | 406.56 | 508.2 | 609.84 | |
| Total Volume: | 242 | 484 | 726 | 968 | 1210 | 1452 |
Place the tubes against a magnetic rack and wait until liquid becomes clear (1-2 min).
With the beads still on the magnetic rack, remove the supernatant and wash with 125 uL of UltraPure H2O.
DO NOT RE-SUSPEND THE BEADS!
Re-suspend beads in 100 uL of the PCR mix.
Run the following thermocycler protocol:
| A | B | C | |
| Step | Time | Temperature | |
| 1 | 3 min. | 95°C | |
| Begin Cycling | |||
| 2 | 20 sec. | 98°C | |
| 3 | 45 sec. | 65°C | |
| 4 | 3 min. | 72°C | |
| 5 | Go to Step 2; Repeat 4X | ||
| 6 | 20 sec. | 98°C | |
| 7 | 20 sec. | 67°C | |
| 8 | 3 min. | 72°C | |
| 9 | Go to Step 8; Repeat for variable # of cycles depending on nuclei/cell count | ||
| 10 | 5 min. | 72°C | |
| 11 | Hold Forever | 4°C |
Place the tubes against a magnetic rack and wait until the liquid is clear (1-2 min.)
Transfer 90 uL of the supernatant from each sub library into a new tube of an 8-tube PCR strip.
Add 72 uL of SPRI beads to each tube for a 0.8X cleanup.
Vortex briefly to mix and incubate for 5 min. to bind the cDNA.
Place the tubes against a magnetic rack and wait until the liquid is clear (1-2 min.)
With the tubes still on the magnetic rack, wash with 180 uL of 85% ethanol.
DO NOT RE-SUSPEND THE BEADS!
Repeat once for a total of 2 washes.
Remove any residual ethanol with a P20 pipette and air dry beads for 3-5 minutes on the magnetic rack.
Do not let the beads over dry (they will turn light brown and crack).
Remove the beads from the magnet and re-suspend in 22 uL of RNase, DNase free H2O.
Incubate for 10 min. at 37°C in a thermocycler.
Place the tubes against a magnetic rack and wait until the liquid is clear (1-2 min.)
Transfer 20 uL of the eluting into a new PCR tube.
Evaluate quality of cDNA libraries via Qubit and the Agilent Tapestation or Bioanalyzer.
Expected concentration will vary: ~10-50 ng.ul
Expected size range: 500-2500bp
10. Fragmentation, End Repair, A-tailing and Adapter Ligation
Make annealing buffer (10X).
| A | B | C | D | |
| Component | Final Conc. | Stock Conc. | Volume (mL) | |
| Tris-HCL, pH 8.5 | 100 mM | 1M | 1 mL | |
| NaCl | 500 mM | 5M | 1 mL | |
| EDTA | 10 mM | 0.5M | 0.2 mL | |
| Water | NA | NA | 7.8 mL | |
| Total Volume: | 10 mL |
Stock can be stored at RT.
Re-suspend BC_0243 & BC_0244 in 1X annealing buffer to a concentration of 100 µM.
Pool adapters prior to annealing:
| A | B | |
| Component | Volume | |
| BC_0243 (100 uM) | 100 uL | |
| BC_0244 (100 uM) | 100 uL | |
| Total Volume: | 200 uL |
Anneal adapter oligos:
- Heat to 94 °C for for00:02:00
- Ramp down to 20 °C to at a rate of -0.1C/s
- Hold at 4 °C
2m
Aliquot annealed adapter in 25 uL aliquots and store at -20°C.
Dilute desired amount (ng) of sample in 10 mM Tris-HCl, pH 8.5 to a final volume of 35 uL.
Note: 25 - 100 ng of cDNA can be used as input for fragmentation (per sublibrary).
Pre-cool a thermocycler to 4°C with the lid set to 50°C.
Assemble fragmentation reaction on ice:
| A | B | |
| Component | Volume | |
| cDNA | 35 uL | |
| KAPA Frag Buffer (10X) | 5 uL | |
| KAPA Frag Enzyme | 10 uL | |
| Total Volume: |
Vortex gently and spin down. Place the tubes immediately back on ice and proceed to the next step.
Place tubes in the pre-cooled thermocycler and start the following protocol:
| Step | Temp | Time | |
| Pre-cool block | 4°C | N/A | |
| Fragmentation | 32°C | 10 min. | |
| HOLD | 4°C | forever |
Transfer reactions to ice, and proceed immediately to end repair and A-tailing.
In the same tubes in which enzymatic fragmentation was performed, assemble each end repair and A-tailing reaction as follows:
| Component | Volume | |
| Fragmented cDNA | 50 uL | |
| ER & A-tailing Buffer | 7 uL | |
| ER & A-tailing enzyme mix | 3 uL | |
| Total Volume: | 60 uL |
Vortex gently and spin down briefly. Return the reaction tubes to ice. Proceed immediately to the next step.
Incubate in a thermocycler programmed as outlined below. A heated lid is required for this step. If possible, set the temperature of the heated lid to ~85°C (instead of the usual 105°C).
| Step | Temp | Time | |
| End Repair and A-tailing | 65°C | 30 min. | |
| HOLD | 4°C | forever |
Transfer tubes to ice. In the same tubes assemble the adapter ligation reaction as follows:
| A | B | |
| Component | Volume | |
| ER and A-tailing rxn | 60 uL | |
| Adapter Stock (50 uM) | 5 uL | |
| PCR-grade water | 5 uL | |
| Ligation Buffer | 30 uL | |
| DNA Ligase | 10 uL | |
| Total Volume | 110 uL |
Mix 10X with a P100 pipette and spin down briefly.
Incubate the tubes in a thermocycler at 20°C for 15 min. (set the lid to "off")
Add 88 uL of SPRI beads to each tube for a 0.8X cleanup.
Mix thoroughly by vortexing and/or pipetting up and down multiple times (10X).
Incubate the tube at room temperature for 5 min to bind DNA to the beads.
Place the tubes on a magnet to capture the beads. Incubate until the liquid is clear. (1-2 min.)
Carefully remove and discard the supernatant without disturbing the beads.
Keeping the tubes on the magnet, add 200 μL of 85% ethanol.
Incubate the tubes on the magnet at room temperature for ≥30 sec.
Carefully remove and discard the ethanol.
Repeat Steps 128-130 for a total of two washes.
Remove any residual ethanol with a P20 pipette and air dry beads for 3-5 minutes on the magnetic rack.
Do not let the beads over dry (they will turn light brown and crack).
Remove the beads from the magnet and re-suspend in 23 uL of RNase, DNase free H2O.
Incubate the tubes at 37°C for 10 min. in a thermocycler.
Place the tubes against a magnetic rack and wait until the liquid is clear (1-2 min.)
Transfer 21 uL of the eluting into a new PCR tube.
11. Sublibrary Indexing and Amplification
Set up PCR reaction as follows:
| Component | Volume | |
| 2X KAPA HiFi Master Mix | 25 uL | |
| BC_0027 (10 uM) | 2 uL | |
| BC_0070-BC_0093 (10uM) | 2 uL | |
| cDNA | 21 uL | |
| Total Volume | 50 uL |
Run thermocycler protocol:
| A | B | C | |
| Step | Temp | Time | |
| 1 | 95°C | 3 min. | |
| 2 | 98°C | 20 sec. | |
| 3 | 67°C | 20 sec. | |
| 4 | 72°C | 3 min. | |
| Repeat 2-4 | *10-16 cycles | ||
| 5 | 72°C | 5 min. | |
| 6 | 4°C | Forever |
*The number of cycles will need to be optimized based on input (ng).
Add 30 uL of SPRI beads to each sublibrary. (Total volume: 80 uL)
Mix thoroughly by vortexing and/or pipetting up and down multiple times (10X).
Incubate at RT for 5 min.
Place the tubes on a magnet to capture the beads. Incubate until the liquid is clear. (1-2 min.)
Transfer 75 uL of clear supernatant into new PCR tubes. Discard beads.
DO NOT DISCARD SUPERNATANT!
Add 10 uL of SPRI beads to each tube. (Total Volume: 95 uL)
Mix thoroughly by vortexing and/or pipetting up and down multiple times (10X).
Incubate at RT for 5 min.
Place the tubes on a magnet to capture the beads. Incubate until the liquid is clear. (2-3 min.)
With the tubes still on the magnetic rack, wash with 180 uL of 85% ethanol.
DO NOT RE-SUSPEND THE BEADS!
Repeat once for a total of 2 washes.
Remove any residual ethanol with a P20 pipette and air dry beads for 3-5 minutes on the magnetic rack.
Do not let the beads over dry (they will turn light brown and crack).
Remove the beads from the magnet and re-suspend in 22 uL of RNase, DNase free H2O.
Incubate for 10 min. at 37°C in a thermocycler.
Place the tubes against a magnetic rack and wait until the liquid is clear (1-2 min.)
Transfer 20 uL of the eluting into a new PCR tube.
Evaluate quality of cDNA libraries via the Agilent Tapestation or Bioanalyzer.
Expected size range: 300-600 bp (peak 400 bp)
12. Sequencing Requirements
Recommended minimum sequencing depth: 20,000 read pairs/cell
Required sequencing parameters:
| A | B | C | D | E | |
| Read 1 | i7 index | i5 index | Read 2 | ||
| Purpose | Insert | Sample index | Sample index | Cell Barcode & UMI | |
| Length | 100 | 6 | 0 | 94 |
It is recommended to add 5% phiX to the final sequencing libraries to increase library diversity and improve sequencing quality.
Protocol references
Rosenberg AB, Roco CM, Muscat RA, Kuchina A, Sample P, Yao Z, Graybuck LT, Peeler DJ, Mukherjee S, Chen W, Pun SH, Sellers DL, Tasic B, Seelig G. Single-cell profiling of the developing mouse brain and spinal cord with split-pool barcoding. Science. 2018 Apr 13;360(6385):176-182. doi: 10.1126/science.aam8999. Epub 2018 Mar 15. PMID: 29545511; PMCID: PMC7643870.
Kuchina A, Brettner LM, Paleologu L, Roco CM, Rosenberg AB, Carignano A, Kibler R, Hirano M, DePaolo RW, Seelig G. Microbial single-cell RNA sequencing by split-pool barcoding. Science. 2021 Feb 19;371(6531):eaba5257. doi: 10.1126/science.aba5257. Epub 2020 Dec 17. PMID: 33335020; PMCID: PMC8269303.