Aug 09, 2023

Protocol for quantification of BdDV-1 mycovirus of Batrachochytrium dendrobatidis by qPCR

Protocol for quantification of BdDV-1 mycovirus of Batrachochytrium dendrobatidis by qPCR
  • Rebecca A. Clemons1,2,
  • Timothy Y. James2
  • 1University of Texas at Austin;
  • 2University of Michigan
Icon indicating open access to content
QR code linking to this content
Protocol CitationRebecca A. Clemons, Timothy Y. James 2023. Protocol for quantification of BdDV-1 mycovirus of Batrachochytrium dendrobatidis by qPCR. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpjkydgzp/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 11, 2023
Last Modified: August 09, 2023
Protocol  Integer ID: 80313
Keywords: BdDV-1 qPCR, fungus batrachochytrium dendrobatidi, batrachochytrium dendrobatidi, real time quantitative pcr with taqman probe, quantitative pcr, qpcr, qpcr this protocol, dna extract, applied biosystem, cdna library
Funders Acknowledgements:
Gordon and Betty Moore Foundation
Grant ID: 9337
Abstract
This protocol is used for quantifying the amount of the DNA mycovirus BdDV-1 in DNA extracts or cDNA libraries.  This virus is associated with the fungus Batrachochytrium dendrobatidis (Bd), and it is known to be endogenized in the genome of a large number of Bd strains. The assay uses real time quantitative PCR with Taqman probes. Setup of the reaction is typically done in a biosafety cabinet. This protocol has been optimized on a QuantStudio 3 (Applied Biosystems).
Attachments
Guidelines
Notes:

  • BdV F: CCTGAGTACCCTGATCACAATGT
  • BdV R: GGGTCATTGGTCGTATCTTCA
  • BdV Probe: MBGNFQ-CCATGGTGGCGTTCT-NED

Standards for viral copy number were created by cloning PCR products from BdV F and BdV R primers into pCR 2.1-TOPO vector using the TOPO TA cloning kit. Plasmids from transformed E. coli colonies with successful insert were extracted using the Zyppy Plasmid Miniprep kit. DNA of plasmid extracts was quantified with a Qubit. Plasmid copy numbers were estimated using the formula:

Number of copies per uL = [(g/uL) / plasmid length in bp * 650)] * (6.022 * 1023)

Extracts were then diluted to a final concentration of 106 viral copies per total 35uL volume for qPCR standards.
Materials
Materials:

  • 96 well optical qPCR plate (Applied Biosystems 4306737)
  • p1000, p200, p20, p10 pipettes
  • Barrier tips for all pipettes (recommend using a new unopened box of 10uL tips)
  • Optical adhesive sealing film (Applied Biosystems 4311971)
  • Tabletop centrifuge (for spinning down samples and reagents)
  • Large centrifuge (for spinning down 96 well plate)
  • PCR water
  • Radiant Probe Lo-ROX qPCR Kit (Alkali Scientific QP9005)
  • BdV F and BdV R Primers (18 micromolar (µM) )
  • BdV Probe (5 micromolar (µM) )—light sensitive, tubes should be wrapped in aluminum foil when not in use
  • BSA (400 ng/µl )
  • 106 BdDV-1 standard

MicroAmp™ Optical 96-Well Reaction Plate with BarcodeThermo FisherCatalog #4306737

ABI prism optical adhesive coversThermo Fisher ScientificCatalog #4311971

Radiant™ Probe Lo-ROX qPCR KitsAlkali ScientificCatalog #QP9005




Protocol:
15m 41s
Wipe down pipettes with 70% ethanol and place in the biosafety hood with tips and 96 well plate. UV for at least 00:15:00 (longer is fine).

15m
After setting up hood to UV, prepare standard dilutions on the bench using barrier tips. Fill 6 1.5uL microcentrifuge tubes with 90 µL of PCR water. Label the tubes 105-100.

Add 10 µL of the 106 virus standard to the 105 tube, pipetting up and down several times to mix.
Repeat this, adding 10 µL from the 105 tube to the 104 tube and so on. You should have 7 standards total, 106-100.
Prepare the master mix in the biosafety hood. All reagents can be thawed quickly on the bench, flicked to mix, and briefly spun down on a tabletop centrifuge before preparation. All the reagents and master mix should be kept On ice during the preparation. Volumes per well:
AB
Radiant Probe Lo-ROX qPCR Kit12.5 uL
PCR water2.75 uL
BdV F primer (18 uM)1.25 uL
BdV R primer (18 uM)1.25 uL
BdV probe (5 uM) –protect from light when not in use1.25 uL
BSA (400 ng/uL)1 uL
Multiply above values by the total number of wells on the plate that will be used plus an additional 2 wells for pipette error. Standards and negative control should be run in triplicate, samples should be run in duplicate. If total master mix volume exceeds 1.5 mL , divide total volume in 2 and prepare master mix in 2 identical 1.5mL tubes. Add the appropriate amount of each reagent to each 1.5mL tube, working On ice with barrier tips. Once all the reagents have been added, flick the tubes to mix and briefly spin down. Return the tubes to the ice.

Add master mix to the 96 well plate. Put the plate on a 96 well rack and place it On ice . Add 20 µL of master mix to each well on the plate that will be used. A single barrier tip can be used for all the wells.
Add standards and samples to the 96 well plate. Standard tubes (prepped in step 2) and samples should be thawed, flicked to mix, and briefly spun down on a tabletop centrifuge. Add 5 µL of each standard or sample to the appropriate well, using a new 10uL tip for each well. If you are using a new box of tips, you can use the placement of tips in the box to help keep track of which wells have been loaded. Negative control wells should be loaded with PCR water. Example plate setup below (where RAC### are experimental sample numbers):
ABCDEFGHIJKLM
1 2 3 4 5 6 7 8 9 10 11 12
A 10^6 10^6 10^6 RAC70 RAC70 RAC84 RAC84 RAC108 RAC108 RAC123 RAC123 RAC136
B 10^5 10^5 10^5 RAC71 RAC71 RAC85 RAC85 RAC110 RAC110 RAC126 RAC126 RAC136
C 10^4 10^4 10^4 RAC72 RAC72 RAC86 RAC86 RAC111 RAC111 RAC127 RAC127 RAC137
D 10^3 10^3 10^3 RAC73 RAC73 RAC87 RAC87 RAC117 RAC117 RAC131 RAC131 RAC137
E 10^2 10^2 10^2 RAC80 RAC80 RAC88 RAC88 RAC118 RAC118 RAC132 RAC132 RAC138
F 10^1 10^1 10^1 RAC81 RAC81 RAC89 RAC89 RAC120 RAC120 RAC133 RAC133 RAC138
G 10^0 10^0 10^0 RAC82 RAC82 RAC101 RAC101 RAC121 RAC121 RAC134 RAC134 RAC139
H negative negative negative RAC83 RAC83 RAC106 RAC106 RAC122 RAC122 RAC135 RAC135 RAC139
Once all samples have been added to the plate, seal the plate with optical adhesive sealing film. Make sure that the edges and corners are well sealed. Using the corner of a plastic sealing tool to press down the edges and corners is helpful.
Spin down the entire plate in a centrifuge briefly to make sure the liquid is at the bottom of the wells. Try to remove any bubbles be gently tapping the plate against the bench and spinning again.
Set up the qPCR machine for the run. Make sure that the plate is On ice while you are doing this step (it can also be done ahead of time).
Open up the QuantStudio software. Name the experiment. Set Run Mode to “Fast”.
Make sure total well volume is set to 25 µL . Run conditions are:
  1. 95 °C for 00:00:20 (set ramp up to 3.96)
  2. 50 cycles of:95 °C for 00:00:01 (set ramp up to 3.96) then 60 °C for 00:00:20 (ramp down to 3.02).
41s
Input the names for your wells into the software. This can be done manually or by copying and pasting the sample names in a list format from excel, where wells are labeled 1-96 and sample names are listed in order of A1-A12, then B1-12, etc.
Mark all of the standard wells as standards in the software. Input the correct quantities for each of the standards (e.g., the quantity for the 106 sample should be input as 1000000).
Label the negative control wells as negatives and the rest of the occupied wells as sample wells (or unknowns).
Place the 96 well plate into the machine (making sure it is in the correct orientation) and start the run!
At the end of the run, check the standards to make sure that the replicates reasonably overlap with one another and that there is no amplification in the negative controls. It is not unusual to have outliers or no amplification in some of the lower dilutions. Check the standard curve. Efficiency should be between 90-110%, R2 should be as close to 1 as possible, and error should be as close to 0 as possible. If necessary, outlier standard replicates can be removed in the software to change these values and the samples can be reanalyzed.
Export your data as an .xls file. This will contain the quantities for each sample, including the mean and SD of the replicates.