Jun 18, 2026
Protocol for ebolavirus qPCR TaqMan multiplex assay (Bundibugyo ebolavirus, Zaire ebolavirus, Sudan ebolavirus, and human internal control)
- Elyse Stachler1,
- Kyle McMahon1,
- Stella Nielsen1,
- Hannah Knoll1,
- Colby Wilkason1,
- Al Ozonoff1,
- Pardis Sabeti1
- 1Broad Institute of MIT and Harvard
- Diagnostic Assay Protocols
Protocol Citation: Elyse Stachler, Kyle McMahon, Stella Nielsen, Hannah Knoll, Colby Wilkason, Al Ozonoff, Pardis Sabeti 2026. Protocol for ebolavirus qPCR TaqMan multiplex assay (Bundibugyo ebolavirus, Zaire ebolavirus, Sudan ebolavirus, and human internal control). protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvmdxe5v3p/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 16, 2026
Last Modified: June 18, 2026
Protocol Integer ID: 319284
Keywords: ebolavirus qpcr taqman, protocol for ebolavirus qpcr taqman, complementary diagnostic format for ebolavirus surveillance, target detection among the ebolavirus, ongoing surveillance of ebolavirus, bundibugyo ebolavirus in response, zaire ebolavirus, ebolavirus surveillance, sudan ebolavirus, whole viral ebolavirus rna, bundibugyo ebolavirus, ebolavirus, target virus across serial dilution, multiplex assay, target virus, essential for both outbreak response, causative virus, outbreak response, targeted qpcr, specific assay, rapid molecular diagnostic, target multiplex taqman rt, outbreak, complementary diagnostic format, qpcr, assay
Abstract
Rapid molecular diagnostics are essential for both outbreak response and ongoing surveillance of ebolaviruses. In earlier work, we developed and analytically validated a targeted qPCR assay for Bundibugyo ebolavirus in response to the 2026 outbreak in the Democratic Republic of the Congo. Here, we extend that work by developing a four-target multiplex TaqMan RT-qPCR assay that differentiates Bundibugyo, Zaire, and Sudan ebolaviruses while incorporating a human internal control. The multiplex assay preserved analytical performance relative to singleplex formats, with amplification efficiencies of 95.8–100.5%, linear standard curves with R² values ≥ 0.99, and an LOD95 of 5 copies/reaction for all viral and internal control targets. In contrived clinical samples consisting of whole viral ebolavirus RNA spiked into healthy human plasma, the assay detected each on-target virus across serial dilutions and showed no unintended off-target detection among the ebolaviruses tested. These results provide a complementary diagnostic format for ebolavirus surveillance: whereas outbreak-specific assays can be rapidly updated and deployed once a causative virus is identified, multiplex assays can support broader screening, differential diagnosis, and preparedness before and between outbreaks.
Guidelines
Patient blood/serum/plasma collection and testing for this protocol requires prior approval by the users' Institutional Ethics Board or equivalent ethics committee.
Materials
- Luna® Probe One-Step RT-qPCR Kit (No ROX) Protocol (NEB# E3007)
- General lab plastics (qPCR plates, microcentrifuge tubes, etc.)
- Primers and probes:
| Name | Sequence (5' > 3') | Fluorophore | Final Assay Concentration (nM) | |
| BDBV_FP | TAACTCATCCACAGACCCCA | - | 400 | |
| BDBV_RP | GATGGCGCCGAAACTATAGA | - | 400 | |
| BDBV_P | CTCACATATCCTAAGGTTGGGCTCC | HEX | 200 | |
| Z-EBOV_FP | ACAAATTGGATGCTCTACATGT | - | 400 | |
| Z-EBOV_RP | TCCACCAGAAAACCCATGTT | - | 400 | |
| Z-EBOV_P* | TGAGCAGTATTGAA+ATT+GGAA+CTCA | FAM | 200 | |
| S-EBOV_FP | ACCGACATTTAGACACTCAAGT | - | 400 | |
| S-EBOV_RP | ATAATCTTGCAGCGTCCGAT | - | 400 | |
| S-EBOV_P | TGGGACTGCAGGTGACCGTG | Cy5 | 200 | |
| mcirDNA_FP | GACCCACCAATCACATGC | - | 400 | |
| mcirDNA_RP | TGAGAGGGCCCCTGTTAG | - | 400 | |
| mcirDNA_P | AGTAAAACCCAGCCCATGACCC | ROX | 200 | |
| Z-EBOV_gblock | gaaatTAATACGACTCACTATAgggCAGCTGATTGACCAGTCTTTGATTGAGCCCTTAGCAGGAGCCCTTGGTCTGATCTCTGATTGGCTGCTAACAACCAACACTAACCATTTCAACATGCGAACACAACGTGTCAAGGAACAATTGAGCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACAAATTGGATGCTCTACATGTCGTGAACTACAACGGATTGTTGAGCAGTATTGAAATTGGAACTCAAAATCATACAATCATCATAACTCGAACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCAAGAAGCCTGGGCCGGCGAAATTTTCCCTCCTTCATGAGTCTACACTGAAAGCATTTACACAAGGATCCTCGACACGAATGCAAAGTTTGATTCTTGAATTTAATAGCTCTCTTGCTATCTAACTAAGATGGAATACTTCATATTGAGCTAACTCATATATGCTGACTCAATAGTTATC | - | - | |
| S-EBOV_gblock | gaaatTAATACGACTCACTATAgggTTAGCAGCGGTGAAACAAGATCCTTCACAACCCACTTCTTAACGTATCCCAAAATAGGGCTCCTATACAGTTTTGGAGCCCTCATAAGTTTTTATTTGGGTAATACTATTCTGTGCACGAAAAAGATCGGACTCACAGAATTTCTATACTATCTCCAGAATCAGATCCACAACTTATCACACAGATCCCTTCGAATCTTCAAACCGACATTTAGACACTCAAGTGTCATGTCCAGGTTGATGGATATAGACCCCAACTTCTCAATATATATTGGTGGGACTGCAGGTGACCGTGGATTATCGGACGCTGCAAGATTATTTCTCCGAATTGCAATTTCAACTTTCTTGAGCTTTGTTGAGGAGTGGGTTATCTTTAGGAAGGCAAACATCCCACTATGGGTTATCTATCCTCTCGAAGGCCAACGCCCTGATCCTCCTGGCGAATTTTTGAACCGAGTAAAATCTCTAATTATTGGGACTGAAGATGATAAAAATAAAGGT | - | - | |
| BDBV_gblock | gaaatTAATACGACTCACTATAgggTACCTAACCTACACGTCTACGCTTTCCTTGGATCTCACAAGGTACCGAGAGAATGAGTTAATTTATGATAACAATCCGTTAAAAGGTGGACTTAATTGCAACCTATCCTTTGATAATCCACTTTTCAAGGGCCAAAGGCTCAATATCATAGAGGAGGATTTGATTAGATTTCCTCATCTATCTGGGTGGGAACTTGCGAAAACCATCATTCAGTCCATTATCTCAGACAGCAATAACTCATCCACAGACCCCATTAGCAGTGGAGAAACACGATCATTCACAACTCACTTTCTCACATATCCTAAGGTTGGGCTCCTCTATAGTTTCGGCGCCATCGTGAGTTATTACTTAGGGAATACCATTATTAGGACCAAAAAGCTAGACCTCAGTCATTTTATGTATTACTTAACAACTCAAATCCATAATTTGCCACATCGCTCGTTGAGGATACTTAAGCCCACCTTTAAACATGTTAGTGTGATATCAAGACTAATGAGTAT | - | - | |
| mcirDNA_gblock | TCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGTCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAACTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTA | - | - |
*The Z-EBOV probe has locked nucleic acids (LNAs) as indicated by + followed by the base.
Before start
- Any One-Step RT-qPCR Kit should be compatible with the below protocol. If using a different kit than the one listed, be sure to first validate a standard curve before running patient samples. The protocol/cycling conditions may need to be updated to be compatible with the available kit.
- This protocol requires nucleic acid extraction from plasma prior to running the qPCR. While the protocol is validated for extracted plasma, extraction from whole blood or serum will likely be compatible. A test to check for PCR inhibition should be done before using a sample matrix other than plasma.
Protocol
Thaw qPCR mastermix, primers, and probes at room temperature. After components are thawed, briefly mix by inversion or gentle vortexing. Briefly centrifuge or flick the tube to collect liquid at the bottom before opening the tubes.
Prepare Probe and Primer Mix (PPM) stocks according to the following recipe (can be multiplied to make a large volume and frozen into smaller volume aliquots). One PPM should be made for each of Bundibugyo, Zaire, Sudan, and mcirDNA:
| PPMs | µL | |
| FP (100µM) | 10 | |
| RP (100µM) | 10 | |
| Probe (100µM) | 5 | |
| Water or Buffer | 75 | |
| Total | 100 |
Prepare enough master mix according to the table below. The table accounts for plating triplicate 10µL reactions per sample and includes overage. If running a standard curve, ensure these are included in the sample count. Minimally, run a positive control and a no template control (NTC) per plate.
| Component | 30µL rxn | Overage | Total to make (for 8 rxns) | |
| Luna Universal Probe One-Step Reaction Mix (2X) | 15.00 | 18.00 | 172.80 | |
| Luna WarmStart‱ RT Enzyme Mix (20X) | 1.50 | 1.80 | 17.28 | |
| Bundi PPM | 1.20 | 1.44 | 13.82 | |
| Zaire PPM | 1.20 | 1.44 | 13.82 | |
| Sudan PPM | 1.20 | 1.44 | 13.82 | |
| mcirDNA PPM | 1.20 | 1.44 | 13.82 | |
| Template RNA | 3.00 | 3.60 | - | |
| Nuclease-free Water | 5.70 | 6.84 | 65.66 | |
| TOTAL: | 30.00 | 36.00 | 345.60 |
Gently mix mastermix and spin down to ensure uniformity. Aliquot 32.4µL of mastermix per well in a 96-well plate according to the number of samples being run.
Pipette 3.6µL of extracted plasma (or positive control material or water for an NTC).
Gently vortex and spin down plate.
Pipette triplicate 10µL reactions into a 96-well or 384-well plate. Seal plate with an optical seal compatible with the qPCR machine being used.
Briefly spin plate to collect liquid at the bottom.
Program the qPCR machine according to the following:
Reaction volume: 10µL
Fluorophores: FAM, HEX, ROX, Cy5
Ensure there is a plate read step at the end of each extension cycle
Cycling conditions:
| Step | Temperature (℃) | Time | Cycles | |
| Reverse Transcription | 55 | 10 minutes | 1 | |
| Initial Denaturation | 95 | 1 minute | 1 | |
| Denaturation | 95 | 10 seconds | 40 | |
| Annealing and Extension | 60 | 30 seconds |