Jun 09, 2025

Protocol for CRISPR screening by AAV episome sequencing (CrAAVe-seq) for cell type-specific CRISPR screens in vivo

Protocol for CRISPR screening by AAV episome sequencing (CrAAVe-seq) for cell type-specific CRISPR screens in vivo
  • Indigo Rose1,
  • Biswarathan Ramani1,
  • Andrew Pan1,
  • Martin Kampmann1
  • 1University of California, San Francisco
  • Indigo Rose: These authors contributed equally
  • Biswarathan Ramani: These authors contributed equally
  • KampmannLab
Icon indicating open access to content
QR code linking to this content
Protocol CitationIndigo Rose, Biswarathan Ramani, Andrew Pan, Martin Kampmann 2025. Protocol for CRISPR screening by AAV episome sequencing (CrAAVe-seq) for cell type-specific CRISPR screens in vivo. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbz4o3gpk/v1
Manuscript citation:
Ramani B*, Rose IVL*, Teyssier N, Pan A, Danner-Bocks S, Sanghal T, Yadanar L, Tian R, Ma K, Palop JJ, Kampmann M. CRISPR screening by AAV episome-sequencing (CrAAVe-seq) is a highly scalable cell type-specific in vivo screening platform. bioRxiv [Preprint]. 2024 Oct 27. doi: 10.1101/2023.06.13.544831. PMID: 37398301; PMCID: PMC10312723.
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 07, 2024
Last Modified: June 09, 2025
Protocol  Integer ID: 102957
Keywords: CrAAVe-seq, Functional genomics, CRISPR screen, CRISPRi, In vivo, AAV, effective crispr, significant need for scalable crispr, specific crispr screens in vivo, scalable crispr, crispr, sensitive sgrna construct for pooled screening, specific crispr screen, sgrna sequences from aav episome, genetic element into the sgrna library backbone, sgrna frequencies from whole brain homogenate, cre recombinase, selective screening of phenotype, sensitive sgrna construct, quantifying sgrna frequency, genetic screening method, sgrna sequence, sgrna library backbone, based genetic screening method, targeted cell population, cell populations in the mouse brain, cre
Funders Acknowledgements:
Ben Barres Early Career Acceleration Award from the Chan Zuckerberg Neurodegeneration Challenge Network
Grant ID: N/A
Tau Consortium Investigator Award
Grant ID: N/A
NIH/NIA grant R01 AG082141
Grant ID: R01AG082141
UCSF-CIRM Scholars Training Program, CIRM grant
Grant ID: EDUC4-12812
UCSF Hillblom/BARI Graduate Fellowship Award
Grant ID: N/A
NIH/NINDS grant R25 NS070680
Grant ID: R25NS070680
NIH/NINDS grant K08 NS133300
Grant ID: 1K08NS133300
Abstract
There is a significant need for scalable CRISPR-based genetic screening methods that can be applied in mammalian tissues in vivo while enabling cell type specificity. Here, we developed an adeno-associated virus (AAV)-based CRISPR screening platform, CrAAVe-seq, that incorporates a Cre-sensitive sgRNA construct for pooled screening within targeted cell populations in the mouse brain. Incorporating a Cre recombinase-based genetic element into the sgRNA library backbone enables the selective screening of phenotypes caused by genetic perturbations only in cell types of interest. Furthermore, CrAAVe-seq exploits the amplification of sgRNA sequences from AAV episomes, rather than genomic DNA, to dramatically increase the scalability and reduce the cost of quantifying sgRNA frequencies from whole brain homogenate. This approach yielded highly reproducible top hits across independent mice. Therefore, CrAAVe-seq enables high-throughput, cost-effective CRISPR screening directly in the mammalian central nervous system, with immediate applicability to other cell types and tissues.
Image Attribution
All images in this protocol were created by Indigo Rose (2025).
Materials
  1. Dounce Homogenizers, 7 ml Pyrex (Corning, 7722-7), with Type A pestle (0.0045 nominal clearance) or equivalent
  2. TRIzol reagent (Invitrogen, 15596026)
  3. 2-Propanol, molecular biology grade (e.g. Sigma, I9516)
  4. Chloroform, molecular biology grade (e.g. Sigma, C2432)
  5. Ethanol, molecular biology grade, 200 Proof (e.g. Sigma, E7023)
  6. DNase/RNase-free water, molecular biology grade (e.g. Gibco, 10977015)
  7. RNase A (Thermo, EN0531)
  8. 5 ml or 2 ml low-bind centrifuge tubes, DNase/RNase-free (e.g. Eppendorf, 0030119487; Thermo, 5453)
  9. PCR strip tubes, sterile, DNase/RNase-free (e.g. Olympus, 27-125U)
  10. Q5 2X High Fidelity Master Mix (New England Biolabs, M0492S)
  11. SPRI Beads (we home-brew these, see Boswell (2020) Protocols.io, DOI: 10.17504/protocols.io.bkppkvmn, but they can also be purchased commercially: e.g. Beckman Coulter, B23317)
  12. Elution Buffer, 5 mM Tris-Hcl, pH 8.5 (e.g. Machinery-Nagel Buffer AE, 12716563)
  13. 0.5% SDS Solution (for cleaning, dilute in MilliQ water from e.g. Millipore Sigma, 7990-OP), in spray bottle
  14. 70% Ethanol (for cleaning, dilute in MilliQ water from e.g. Fisher, BP82014), put in spray bottle
  15. MilliQ water, in spray bottle
  16. Qubit dsDNA HS Assay Kit (Invitrogen, Q32851) for library quantification
  17. TapeStation reagents (Agilent D5000 High Sensitivity Kit), or agarose gel (e.g. Thermo, 16500100) for library quantification
  18. Common Fwd Primer oMK732 (order custom DNA oligo, e.g. 25 nmol from IDT, standard desalting); see Appendix for sequence
  19. Index primers (Reverse Primers) (order custom DNA oligos, e.g. 25 nmol from IDT, standard desalting); see Appendix for table of sequences
  20. Custom sequencing primer oIR300 (order custom DNA oligos, e.g. 25 nmol from IDT, standard desalting); see Appendix for sequence
Make AAV vectors containing sgRNA library
Clone sgRNA library into CrAAVe-seq plasmid pAP215. Once you have your library, clone it into the pAP215 plasmid backbone (available on Addgene # 217635). We suggest the protocol described in Heo et al (2024), PMID: 38243310 for optimal results.

Optional: Before use, consider sequencing your library using a small number of reads to validate roughly similar representation between individual library elements, and to make sure little or no drop-out occurred during cloning. Aim for >100 reads per element.
Design and order sgRNA library. Determine which library you'd like to use for your screen. For example, pre-made libraries M1-M7 are available, which together target the whole mouse genome (Horlbeck et al (2016), PMID: 27661255).

For custom libraries, determine which genes you want to perturb and look up the associated protospacer sequences in Horlbeck et al. (2016): Supplementary File 4 (for use in mice). To each of these sequences, add the following adaptors to the top and bottom oligos to create the oligo pool (top oligo = protospacer sequence + adaptors; bottom oligo = reverse-complement of protospacer sequence + adaptors)

Top oligo: 5'- TTG + [20 bp sgRNA protospacer sequence (always starts with G)] + GTTTAAGAGC -3’
Bottom oligo: 5'- TTAGCTCTTAAAC + [20 bp reverse complement of protospacer] + CAACAAG -3’

To do this scalably, we recommend using our tool `pyg uide` (https://github.com/pgrosjean/pyguide) which translates a list of genes into the associated protospacer sequences, attaches the above adapters, and generates a list of oligos to order. This list is formatted to be easily uploaded to companies that create oligo pools, such as IDT. We generally use 5 unique sgRNAs per gene. Remember to include non-targeting controls, generally 10-15% although we generally cap at ~250 sgRNAs for large libraries.
Package library into AAV. Once you have your sgRNA plasmid library, package it into AAV. This can be done using using many different protocols, as long as they produce a sufficient titer.

We have optimized a protocol for cost-effective, in-house AAV preparation for use with in vivo CRISPR screening applications. See: Rose, Ramani, Pan, and Kampmann (2025) Protocols.io, DOI: 10.17504/protocols.io.14egn6ezpl5d/v1.

Once AAV to packaged, it can be stored for ~6 months at 4C. Do not freeze.
Transduce mouse brains with AAV
Inject mice with AAV containing sgRNA library (and Cre-encoding plasmid, if not using a Cre-expressing mouse line). For implementing neuron survival screens, we co-inject pAP215 containing a library of sgRNAs together with a Cre-containing plasmid (such as hSyn1-Cre), by intracerebroventricular (ICV) injection.

For ICV injection, we follow the protocol described in Kim et al. (2014), PMID: 25286085.

For ICV, we typically inject unilaterally in the left hemisphere using AAV diluted to 2 µL total volume in PBS. We suggest injecting in the range of: 1 x 1010 to 5 x 1011 viral particles per mouse. You can also achieve similar transduction efficiency by injecting retro-orbitally using higher titers, usually in the range of 1-5 x 1012 viral particles per mouse. Viral titer will need to be adjusted for optimal transduction MOI for your target area, which varies by application and will need to be empirically determined.
Save sample of AAV for sequencing, to compare against as a starting population distribution.

Dilute AAV 1:100:
- 99 μL ultrapure (DNase-/RNase-free) water
- 1 μL library-containing AAV, e.g. pAP215-M1 library PHP.eB AAV
- Use same aliquot used to inject mice
- Store diluted AAV at -80 °C until ready to start CrAAVe-seq Part 2 (See )
Collect & store mouse brains
For survival screens, dissect out whole mouse brain (or regions of interest) and snap-freeze in 2.0 ml tubes on dry ice. Store at -80 °C .

For screens on non-survival phenotypes, dissect out brain (or regions of interest) and dissociate cells or nuclei as desired. Then isolate into populations to compare. This can be done with FACS, MACS, etc.
CrAAVe-seq Part 1: Isolate episomal DNA from brains (in fume hood)
Steps 8–38 can be completed in one afternoon plus one overnight (16 h) incubation.

NOTE: These steps must be completed inside a fume hood or dedicated sample prep hood capable of (1) meeting the ventilation requirements for working with TRIzol reagent, and (2) helping to eliminate contaminating DNA, which dramatically interferes with the screen data. NEVER bring PCR-amplified DNA into this space.

Our workflow is to perform CrAAVe-seq Part 1 inside a normal chemical fume hood which we clean well, and then perform CrAAVe-seq Part 2 (pre PCR) inside a separate dedicated DNA Sample Prep Hood (generally, a Biosafety Cabinet Type II). CrAAVe-seq Part 3 (post PCR) MUST be completed outside of either of these two spaces, typically on a normal lab bench.

In principle, Parts 1 and 2 could be completed in the same hood, so long as this hood is (1) cleaned very well of contaminating DNA, (2) never exposed to post-PCR product, and (3) meets your institution's Environmental Health & Safety requirements for working with TRIzol and chloroform.
Clean fume hood and prepare necessary materials & reagents
Clean DNA contamination from fume hood.
Spray excessively and wipe down the hood and every surface inside hood with the following agents in the following order:
  1. 0.5% SDS & wipe down (to disrupt any biofilms)
  2. Water & wipe down (to solubilize and wipe away ambient DNA - MOST IMPORTANT). Use spray bottle filled with MilliQ water.
  3. 70% Ethanol & wipe down dry (so water doesn't pool and rust metal surfaces -- can omit for non-metal surfaces in fume hood)
Clean dounce homogenizers.
  • Bring dounces & Type A pestles to sink and scrub using brush with 0.5% SDS. Check for any particulates, especially at ends of dounces, and scrub clean.
  • Copiously rinse off with DI water, then bring to fume hood.
  • Dry dounce mortar upside-down so water doesn't pool inside. Dry pestles on paper towels.
Clean following materials/reagents & bring into fume hood. Before placing in hood, spray down each item with (1) 0.5% SDS & wipe down, then (2) MilliQ water and wipe down, then (3) 70% EtOH (only needed for metal surfaces)
  1. Centrifuge and appropriate rotor (if not already inside hood). Must be capable of cooling to 4C, holding 5 ml tubes, and reaching 12,000 x g. If no centrifuge is available that holds 5 ml tubes, can split samples into multiple 2 ml tubes.
  2. TRIzol bottle
  3. Chloroform bottle
  4. 2-Propanol bottle
  5. Ethanol bottle (molecular biology grade)
  6. Ultrapure water, DNase/RNase-free
  7. PCR strip tubes, DNase/RNase-free
  8. 5 ml Eppendorf tubes, DNase/RNase-free (or 2 ml tubes if you're using those instead)
  9. 50 ml tubes, DNase/RNase-free
  10. PCR strip tube rack
  11. Stand for dounce homogenizers
  12. Holder for 5 ml & 50 ml tubes
  13. Holder for 2 ml tubes (for holding brains from freezer)
  14. Liquid waste container for TRIzol/chloroform (use old bottle)
  15. Solid waste container for TRIzol/chloroform-contaminated plastics (waste bag placed in beaker and folded out around edges so it's easy to close)
  16. Pipettes: P1000, P200, and P20
  17. Pipette tips: 1000 μL, 200 μL, and 20 μL tips
  18. Pipette Aid
Gather other materials nearby:
  1. Bucket with water ice
  2. Paper towels (for wiping everything down)
  3. Serological pipettes, a handful of 5 ml, 10 ml, and 25 ml
Label tubes: For each brain, label 1 x 5 ml tube. Our rotor fits 10 x 5 ml tubes total, so we typically prep up to 10 brains at a time.
Retrieve brains from freezer: Bring into fume hood, wiping down with 0.5% SDS, then water. No need to keep on dry ice. Melting slightly helps the TRIzol permeate.
Homogenize the brains in TRIzol
Add TRIzol to dounces:
Add 4 mL TRIzol to each dounce homogenizer (for prepping full brains; if prepping ½ a brain or less, scale down protocol to 2 ml TRIzol)
Dislodge brains:
Use P1000 to take 1 ml of that TRIzol and add to 2 ml tube containing brain. Use tip to dislodge frozen brain. Cap the tube and invert until the brain comes loose from the sides of the tube. This may take a minute and require some slight warming from hands.
Transfer brains to dounces:
Pour out the brain and TRIzol solution into the top of the dounce homogenizer, such that the homogenizer now contains the brain and the full 4 ml of TRIzol solution.
Insert pestles and homogenize: Try not to remove the pestle above the top of the liquid so as to prevent bubbles from forming, although minimal bubble formation is acceptable. Homogenize until the solution appears an almost uniform and homogenous cloudy pink color and all large brain particulates are gone. This may take 20-30+ strokes. Overdouncing is not a huge worry.
Transfer homogenate to tubes:
Remove pestle (place on paper towel) and transfer the brain/TRIzol homogenate into 1 x 5 mL tube per brain. Can use bounce to pour into tube, or transfer with 5 ml serological pipette. TRIzol-contaminated serological pipettes need to be put into dedicated TRIzol solid waste container.
If using a whole brain, there should be almost exactly ~4.2 mL total volume after homogenizing.
Add chloroform
Mix chloroform and homogenate:
Add 800 µL chloroform to each tube already containing TRIzol/brain homogenate.
Mix by inverting tubes 3-4 times. Solution should turn a brilliant "milkshake pink".
Centrifuge 12,000 x g, 15 mins, 4ºC.
While tubes are spinning, retrieve and label new 5 ml tubes, 1 per brain.
15m
Precipitate with 2-propanol
Fill fresh 5 ml tubes with 2 mL 2-propanol per sample
Observe TRIzol phases:
Retrieve tubes from centrifuge.
2 distinct phases should be visible, along with a white interphase. The top phase should be clear and aqueous, it should be a little over 2 mL (this phase contains RNA as well as the episomal DNA we want to collect in this protocol). The bottom phase should be dark pink/purple and be viscous and contains gDNA.
Transfer aqueous phase:
Remove 2 mL of the aqueous (top, clear) phase, and add it to the new 5 ml tube containing the 2-propanol.
DO NOT disrupt the interphase!
Try to remove most of aqueous phase, but it's ok to leave some behind so as not to risk touching the interphase. If you do touch the interphase, put back all the solution and spin again for a second try.
Mix solution:
Mix quickly after adding TRIzol/homogenate solution by inverting tubes 3-4 times.
Incubate on ice for 10 mins to let solution precipitate
10m
Centrifuge 12,000 x g, 10 mins, 4ºC
10m
Wash episome-containing pellet with ethanol
While tubes are spinning, prepare 75% EtOH in DNase/RNase-free water:
Mix 100% Ethanol (mol bio grade) and DNase/RNase-free water (inside hood) Put in a new 50 ml conical tube.
You will need 4 ml per brain.
Discard supernatant:
Retrieve tubes from centrifuge. Discard supernatant by pipetting it up into a non-hazardous waste container. Pellet should be visible: large, white, and whispy.
Try to remove all the solution without disturbing the pellet, but a small amount remaining is acceptable
Add 75% ethanol to tubes:
Add4 mL 75% EtOH to each tube.
Voretx briefly so that pellet detaches from bottom of tube to wash it, but the pellet will not re-solubilize. Can also use P1000 instead of vortex to mix.
Centrifuge 7,500 x g, 5 mins, 4ºC
5m
Remove as much ethanol as possible (while leaving pellet intact):
Remove most ethanol with a serological pipette, then a P1000.
Return tubes to centrifuge to briefly spin them down so traces of ethanol on sides of tube pool at the bottom.
Then use a P20 pipette to remove all remaining liquid.
Open tubes caps and let air-dry for ~10 mins:
Verify that all solution is gone, but do not let tubes over-dry (they get crackly, and then turn from white opaque to clear, making it seem like your pellet has disappeared).
Keep tubes upright in tube rack during this process.
This might take longer, depending on how well you pipetted out the last little remaining buffer from each tube.
Digest pellet with RNase
16h
[Optional] Warm water for elution buffer:
Warm up DNase/RNase-free water on 37 °C heatblock for 5+ mins
This helps the pellet dissolve quicker, but isn't necessary
Add RNase A to water to create elution buffer:
Add 1 µL RNase A per 100 µL of DNase/RNase-free water
You will need 100 µL per brain. If you don't treat with RNase A, then you won't get amplified bands out post-PCR; we tried this.
Dissolve RNA/episomal DNA pellet with elution buffer:
Add 100 µL Elution buffer to each tube.
Pellet should solubilize in a few minutes. Wait for pellet to fully solubilize before moving to the next step. You can help it along by vortexing and briefly spinning down.
Transfer sample to PCR strip tubes:
May need to split sample into 2 x 50 µL depending on the capacity of your thermocycler.
RNase samples:
Incubate tubes at 37 °C for 16 hours in a thermocycler.
Set a thermocycler program for 37ºC for 16 hours, then 4-12ºC hold.
This removes RNA from your sample, leaving it enriched in episomal DNA (which contains sgRNAs for amplification).
16h
Store samples:
Freeze DNA at -20 °C for storage, or move on directly to amplification
CrAAVe-seq Part 2: Prepare PCR Amplification (in DNA Prep Hood)
The following steps (Steps 40–47) MUST be completed inside of a dedicated DNA preparation space (such as a dedicaded DNA Sample Prep Hood) where sources of DNA plasmid contamination can be controlled. Not doing this is an easy way to mess up your screen!

In principle, CrAAVe-seq Parts 1 and 2 could be completed in the same hood, so long as this hood is (1) cleaned well of potential contaminating DNA, (2) never exposed to post-PCR product, and (3) meets your institution's safety requirements for working with TRIzol and chloroform (usually a ducted fume hood). However, CrAAVe-seq Part 2 can also be performed in a separate standard Class II Biological Safety Cabinet since it does not use reagents requiring a ducted fume hood, so long as it meets criteria (1) and (2) above.

Rules for working in the DNA Sample Prep Hood:
  1. Use DNA Sample Prep Hood, DO NOT use RNA Prep Hood or Cell Culture Hoods.
  2. Clean DNA Sample Prep Hood and its contents before and after use. Spray once with (1) 0.5% SDS, wipe down, (2) MilliQ water, wipe down, and (3) 70% ethanol, wipe down dry. Wipe down surfaces inside the hood, including inside the hood centrifuge. DNA is soluble in water, so the DNA washing step is of paramount importance to keeping your samples safe from plasmid contamination that may poison your screen data. The ethanol prevents water from pooling to avoid rust. If your hood is made of composite material instead of metal, ethanol is not necessary. For metal hoods, DO NOT leave the hood wet - the surface starts to rust.
  3. Use fresh gloves and wear disposable sleeves when doing sample prep. Wipe them down with 0.5% SDS, then water, then 70% ethanol.
  4. The pipettes stay inside the hood. DO NOT bring the tube racks/pipets from inside the hood out to the molecular bench. It will be a source of plasmid contamination.
  5. Use only filtered tips inside the hood.
  6. Use only fresh dedicated reagents inside the hood. Before bringing them into the hood, wipe off with 0.5% SDS, then water, then 70% ethanol.
  7. Post-PCR samples or other concentrated sgRNA samples/libraries should NEVER be taken inside the hood.
  8. It’s incredibly important to keep pre-PCR product isolated from any contaminating DNA especially post-PCR DNA as it is amplified. Therefore all steps before the samples are put into the PCR machines are carried out with equipment only used for pre-PCR steps, in the hood. Don’t use pipets that are used for cloning and rinse questionable surfaces with water before performing protocol.
  9. DO NOT leave Q5 polymerase out in the hood for a long time or forget it in the hood - it is expensive!
  10. NEVER use primers directly from the primers stock tubes! Instead, use aliquots to set up PCR to avoid cross-screen contamination of sgRNAs.
  11. When running below 2 aliquots for a given primer, make new aliquots (in the hood! avoid contamination).
  12. When the stock tube has less the 50 µL in it, reorder (see Table of Primers at end of protocol).
  13. Leave the hood clean for the next person: put boxes/pipets away, close pipet boxes, bag tubes, etc.
  14. DO NOT bring AAV into this space under any circumstances. For PCR reactions to amplify AAV, prepare everything but the AAV inside the hood and then add the AAV once you've removed the PCR tubes from the hood.
Set up PCR for sgRNA amplification
Clean hood and reagents:
Clean inside of hood with (1) 0.5% SDS, wipe down, (2) MilliQ water, wipe down, and (3) 70% ethanol, wipe down dry. Do the same with the following materials and reagents:
  1. Ultrapure water
  2. PCR strip tubes
  3. PCR strip tube holders (refreezable, to maintain cool temperature) (from -20°C freezer)
  4. 1.5 ml tubes
  5. 1.5 ml tube holders (standard, room-temp holders)
  6. 1.5 ml tube holder (refreezable, to maintain cool temperature for Q5) (from -20°C freezer)
  7. Q5 2X High-Fidelity Mixer Mix (from -20°C freezer): thaw, briefly spin down, and keep on iced holder to keep cool.
  8. Pipettes and filtered pipette tips
  9. Episomal DNA samples (from Part 1) in PCR strip tubes (thaw and briefly spin down before moving into DNA hood)
Thaw primers and bring into hood:
In addition, thaw necessary primers and bring into hood after cleaning and briefly spinning down as above:
  1. oMK732 (common forward primer)
  2. Necessary number of reverse (index) primers: one inverted (e.g. "Ms_i1" for index 1) primer per brain sample and one uninverted (e.g. "i1" for index 1) per AAV replicate you have in your experiment. (See Appendix)

If you use e.g. inverted index 1 (Ms_i1) for your first sample, you cannot use the uninverted (i1) index for an AAV sample in the same experiment!!! Even though they are different full sequences, the index portion of the sequence is the same for each sample name and they cannot be differentiated during sequencing. This is the same for Ms_i2 and i2, Ms_i3 and i3 etc.

Preventing primer contamination is of paramount importance. Here are some tips:
  • Primers should be initially resuspended to 100 µM and some should be moved to a new stock aliquot. Then, some of this aliquot should be diluted to 10 µM stocks in a fresh tube. These working stocks should be kept in a separate box from the 100 µM stock aliquots, which should themselves be in a separate box from the original 100 µM tubes. If contamination happens, it's then easy to contain.
  • All primer resuspension should happen inside the DNA hood, using Ultrapure, DNase-/RNase-free water.
Transfer episomal DNA samples to 1.5 ml tubes:
May need to pool together the same sample back into one tube if you split them up during .
Samples should be 100 µL total.
It's very important to use a large fraction (or ideally all) of your sample for PCR amplification, as failure to do this can artificially introduce bottlenecking into your screen data. If you're concerned about whether the PCR will work, you can take a small sample (e.g. 5%) of the episomal DNA sample and run a scaled down test PCR to verify you see the presence of the PCR band before proceeding. However, this is usually unnecessary once you get a hang of the protocol.
Create PCR master mix & dispense into 1.5 ml tubes:
Create master mix of 2X Q5 polymerase and oMK732 (common forward primer, 10 µM stock):
ABCD
Vol for 1 rxn (µL)Vol for X rxns (µL)Vol for X rxns + 15% (µL)
2X Q5 High-Fidelity Master Mix110 µL
Common Fwd Primer oMK732 (10 µM stock)5.5 µL
Total:115.5 µL
Sequence of oMK732 is listed in the Appendix.
Dispense 115.5 µL of Q5/oMK732 master mix into the 1.5 mL tubes containing the 100 µL episomal DNA sample. Also add some to fresh 1.5 mL tubes for amplification of reference AAVs, typically 2-3 technical replicates.
Add Index primers, water, & distribute into PCR strip tubes:
Add 5.5 µL of 10 µM Index Primer stocks (reverse primers) to 1.5 mL tubes.
Use a unique index for each sample you have. Make sure to use inverted (mouse) primers (e.g. Ms_i1, Ms_i2, etc.) for episomal DNA isolated from mouse brains and the uninverted primers (e.g. i10, i11, etc.) for AAV samples. Again, ensure no index overlap (i.e. don't use Ms_i1 and i1 in the same experiment).

Add 99 µL RNase-/DNase-free water to each of the tubes that will be used to amplify AAV instead of episomal DNA (see table below). DO NOT bring AAV into the DNA Hood.

Distribute PCR reactants into PCR strip tubes. You may need to split across multiple PCR strip tubes depending on the volume capacity of your thermocycler.

Example spreadsheet for setting up the PCR reactions:
ABCDEFGHIJKLM
Sample NameIndex Primer Long NameIndex Primer Short NameIndex SequenceProduct size (bp)2X Q5 High-Fidelity (µL)10 µM Fwd Primer (oMK732) (µL)Mastermix to add to each PCR tube (µL)10 uM Rev Primer (index) (µL)Nuclease-free Water (µL)Sample Template (µL)NotesPost-SPRI Qubit Conc (ng/µL)
Example Brain 1oIR201_mirror_Ms_i1Ms_i1ATCACG3541105.5115.55.50100
Example Brain 2oIR202_mirror_Ms_i2Ms_i2CGATGT3541105.5115.55.50100
Example Brain 3oIR203_mirror_Ms_i3Ms_i3TTAGGC3541105.5115.55.50100
Example Brain 4oIR204_mirror_Ms_i4Ms_i4TGACCA3541105.5115.55.50100
Example Brain 5oIR205_mirror_Ms_i5Ms_i5ACAGTG3541105.5115.55.50100
Example Brain 6oIR206_mirror_Ms_i6Ms_i6GCCAAT3541105.5115.55.50100
Example Brain 7oIR207_mirror_Ms_i7Ms_i7CAGATC3541105.5115.55.50100
Example Brain 8oIR208_mirror_Ms_i8Ms_i8ACTTGA3541105.5115.55.50100
Example AAV Replicate 1oMK730_HS4Kmirror_CRISPR_index10i10TAGCTT2761105.5115.55.5991AAV is already 1:100 diluted. This step further dilutes.
Example AAV Replicate 2oMK754_HS4Kmirror_CRISPR_index11i11GGCTAC2761105.5115.55.5991AAV is already 1:100 diluted. This step further dilutes.
Example AAV Replicate 3oSEQ12_mirror_i12i12CTTGTA2761105.5115.55.5991AAV is already 1:100 diluted. This step further dilutes.
Totals:110055
Mix to make MM (above +10%):121060.5
Add diluted AAV into AAV reactions:
Thaw previously frozen 1:100 diluted AAV (see: ), vortex and briefly spin down.
Remove PCR strip tubes from DNA hood and bring to bench. Directly add 1 µL of 1:100 (further) diluted AAV into each reaction (or proportionally less if you split the reactions into multiple tubes).

[Optional]: AAV reactions can also be proportionally scaled down to 110.5 µL total (½ volume), to fit into one PCR strip tube.
Run PCR:
Thermocycler settings
ABCDEFG
Step 1Step 2Step 3Step 4Step 5Step 6Step 7
98°C98°C60°C72°CGO TO Step 2, 22X72°C7°C
30 sec30 sec15 sec15 sec(23 times total)10 minHold
23 cycles generally produces enough material without introducing too much PCR bias. However, if you're not starting with much input material, you may want to increase up to 25 total cycles. However, this needs to be consistent across all your samples, including your AAV samples.
Store samples at -20 °C
CrAAVe-seq Part 3: Post-PCR cleanup, QC, and sequencing
The following steps (Steps 49–71) MUST be completed OUTSIDE the previously used DNA preparation space, as this now becomes a major source of potential cross-experiment DNA contamination. This is usually a standard lab benchtop space.
[Optional]: Run sample on gel pre-SPRI to verify correct band size
This step can be helpful before SPRI-selection if you have many samples, as it can narrow down which samples you decide to do SPRI-selection on.

Remove 3 µL of POST-PCR sample and mix with 3 µL of 6X Loading Dye.
Run on a 2% agarose gel, 120V, 40 mins.
Verify inverted (brain) samples create a 354 bp amplicon and AAV samples create a 276 bp amplicon.

Alternatively, can use TapeStation D5000 kit, looking for the same band size information. In addition to the sgRNA amplicon bands, expect to see trace primer dimer and a smear of un-amplified very large DNA species. We suspect this smear is gDNA carryover from incomplete isolation during the TRIzol steps; however, if doesn't pose a problem for the experiment besides minor inference with concentration).
Sample purification by SPRI selection
Make or obtain SPRI Beads:
We home-brew our SPRI breads using the following protocol: Boswell (2020) Protocols.io, DOI: 10.17504/protocols.io.bkppkvmn, but they can also be purchased commercially: e.g. Beckman Coulter, B23317).
Set up reagents/materials:
  • Warm SPRI beads to room temperature 
  • Retrieve magnetic tube holder for 1.5 ml tubes
  • Label 3 sets of 1.5 ml tubes (1 for transfering from PCR stirp tubes initially, 1 for intermediate step, and 1 with full info for final labeling of tubes)
  • Remove post-PCR samples from freezer, thaw, vortex, and briefly spin down
  • Make 80% EtOH: Use molecular biology grade ethanol and RNase-/DNase-free Ultrapure water, make >1 ml for each 100 µL sample
Move 100 µL of PCR product for each sample to a 1.5 ml tube.
This leaves behind remaining 100+ µL of PCR product in case SPRI cleanup fails
Mix SPRI beads by vortexing
Add 65 µL of SPRI beads (0.65X) directly to 100 µL reaction. Mix well.
100 µL * 0.65 = 65 µL SPRIselect. At this ratio, fragments >360 will bind to the beads
This will create a SPRI to sample ratio of 0.65:1 (0.65X)
Mix well. You want a homogenous mixture. If you splash any of the mixture onto the sides of your tubes or cap spin down briefly.
Incubate 5-10 min at RT (until clear)
Place tubes on magnetic stand for 5 minutes or until clear
Transfer supernatant to new 1.5 ml tubes (Keep supernatant)
This should be 165 µL of volume.
It's ok if there is very slightly less.
Add 45 µL of SPRI beads (1.1X) to this supernatant and MIX WELL (vortex or pipetting)
Can even add SPRI beads to new tubes first and then transfer in supernatant 
This will create a SPRI to sample ratio of 1.1:1 (1.1X)
Tube will now contain 210 µL
This concentration will bind fragments smaller than your amplicon and larger, excluding very small fragments
((1.1X-0.65X)*100uL = 45 µL- THIS IS THE CORRECT AMOUNT!)
Incubate 5-10 min at RT (until clear)
Place tubes on magnetic stand for 5 min or until clear.
Remove supernatant (~200 µL), leaving ~10 µL behind.
Wash with 500 µL fresh 80% EtOH. Incubate for 30 sec.
Pipette away from the beads to avoid distrubing them.
Remove EtOH. Repeat wash once.
Dry beads until they are no longer shiny.
Tip: to dry beads faster, spin tubes down. Put tubes on magnet and wait until liquid is clear. Remove residual EtOH w/20 µL pipette tip
Elute with 30 µL Elution Buffer (5 mM Tris-Hcl, pH 8.5) at RT for 2 mins
Save 25 µL supernatant by transfering it to a fresh 1.5 ml tube
Don’t carry over any beads!
Quantify sample concentration using Qubit
Use Qubit dsDNA HS Assay Kit following manufacturer's instructions
DO NOT use NanoDrop for quantification; it is not of sufficient quality for accurate library pooling.
Can record on same spreadsheet in
Run samples on gel to check for bands:
Remove 3 µL of POST-SPRI sample and mix with 3 µL of 6X Loading Dye.
Run on a 2% agarose gel, 120V, 40 mins.
Verify inverted (brain) samples create a 354 bp amplicon and uninverted (AAV reference) samples create a 276 bp amplicon.

Post-SPRI amplicons with successful cleanup of primer dimer showing the expected sizes for n=7 brains and n=3 AAV samples.
Can also use TapeStation D5000 High-Sensitivity Kit for scalable quantification of amplicon size distribution.
Store post-SPRI samples at -20 °C for pooling and sequencing, or move directly to pooling.
Sample pooling and sequencing
Pool samples at equimolor ratio:
Mix samples to create a 5 nM solution, ideally at 20+ µL to have plenty of sample for sequencing.
Submit sample to Sequencing Core (or sequence yourself):
If using a core, follow their procedures for sequencing.
Use custom sequencing primer oIR300 (gactagccttatttaaacttgctatgctgtttccagcttagctcttaaac), or design another primer that will amplify out your sgRNA protospacer sequence.
In house sequencing:
If sequencing yourself, dilute pool to 2 nM with Ultrapure water.
Further dilute 12 µL of 2 nM pool with 12 µL of RSB Buffer (from Illumina) to create 1,000 pM pool.
Dilute 1.8 µL of 100 µM oIR300 custom sequencing primer with 600 µL HT1 Buffer (from Illumina) to create 0.3 µM solution.
We sequence using a P1, P2, P3, or P4 cartridge (depending on scale and using the smallest possible cycle number size, i.e. 50 cycles for P4 or 100 cycles for P1-P3) using an Illumina NextSeq 2000, set for 21 cycles for Read1 and 6 cycles for Index1. Read2 and Index2 are set to 0 cycles.
Further details for our method of in house sequencing available with this attachment:Download NextSeq2000 CRISPR sequencing in Weill · Benchling.pdfNextSeq2000 CRISPR sequencing in Weill · Benchling.pdf119.5KB
Data Analysis
Analysis guidelines:
Alignment and sgRNA counting using `sgcount`:
This tool segments out sgRNA protospacer sequences, aligns them to list of sgRNA sequences, and aligns them to a targeting gene.
Install `sgcount` according to instructions on Github: https://github.com/noamteyssier/sgcount.
You will need to install Rust as well if you don't already have it.
You will need a file containing your library, as well as a file that describes the mapping between your sgRNAs and the genes they target. This is described in detail on the Github.
Here is an example of those two files using the M1 library:
Download m1.uniq.var.fam1.uniq.var.fa548.6KB
Download m1_lib.g2s.txtm1_lib.g2s.txt387KB
You'll need these files in addition to your FASTQ files (after demultiplexing).

Here is an example of a generic alignment and sgRNA counting command using `sgcount`:
sgcount \
-l m1.uniq.var.fa \
-i AAV1.fastq.gz AAV2.fastq.gz AAV3.fastq.gz Brain1.fastq.gz Brain2.fastq.gz Brain3.fastq.gz Brain4.fastq.gz \
-n AAV1 AAV2 AAV3 Brain1 Brain2 Brain3 Brain4 \
-t 4 \
-g m1_lib.g2s.txt \
-o output_mapping.tab

Here is an example output that looks great in terms of mapping percentage (93-95% mapped):
🗸 [00:00:00] Calculated Offsets: [Reverse(2), Reverse(2), Reverse(2), Reverse(2), Reverse(2), Reverse(2), Reverse(2), Reverse(2)] 🗸 [00:00:00] Finished Mismatch Library 🗸 [00:00:17] Finished: AAV1; Fraction mapped: 0.945 [15987734 / 16924499] 🗸 [00:00:17] Finished: AAV2; Fraction mapped: 0.944 [15960711 / 16899431] 🗸 [00:00:17] Finished: AAV3; Fraction mapped: 0.944 [15824146 / 16759777] 🗸 [00:00:07] Finished: Brain1; Fraction mapped: 0.934 [6583635 / 7049013] 🗸 [00:00:16] Finished: Brain2; Fraction mapped: 0.936 [8183618 / 8740398] 🗸 [00:00:25] Finished: Brain3; Fraction mapped: 0.938 [7727089 / 8240609] 🗸 [00:00:25] Finished: Brain4; Fraction mapped: 0.938 [7230034 / 7704155]

[Optional]: Check mapping using `screenviz`:
Install `screenviz` according to instructions on Github: https://github.com/noamteyssier/screenviz.
You will also need Python for this step, as described on the Github.
You can use the QC function in `screenviz` to generate a html dashboard describing the quality metrics of your CRISPR screen:

screenviz qc -i output_mapping.tab

This will generate a link which you copy and paste into a web browser to open the QC utility. It will show you:
  • Correlation plots for each of your samples against any other sample, with the ability to highlight specific sgRNAs
  • Total read counts per sample
  • A sample correlation matrix
  • Distribution of gene membership size
  • Distribution of log10 sgRNA counts

Using sample correlation plots, you can easily check for bottlenecking (which can come from low sequencing read count, or poor sgRNA recovery from brain):

Example showing bottlenecking from poor sgRNA recovery from brain (last plot). Orange dots indicate non-targeting controls (NTCs) and gray dots indicate targeting sgRNAs. The presence of many NTCs dropping out indicates poor sample quality due to bottlenecking. Since this sample was sequenced with >1000X read coverage per sgRNA element, we can infer this is due to biological bottlenecking and not poor sequencing.

sgRNA Aggregation using `crispr_screen`:
This tool aggregates the multiple sgRNAs targeting each gene and performs statistical tests to determine if a gene in a hit or not.
Install `crispr_screen` according to instructions on Github: https://github.com/noamteyssier/crispr_screen.

`crispr_screen` supports 3 different algorithms for calling hits: RRA, INC, and GeoPAGG (for details, see Github or main paper).

Here is an example sgRNA aggregation command using the `test` function using the GeoPAGG algorithm:
crispr_screen test \ -i output_mapping.tab \ -c AAV1 AAV2 AAV3 \ -t Brain1 Brain2 Brain3 Brain4 \ -o Brains_vs_AAVs.txt \ -g geopagg \ --use-product \ -M 0
This uses the `--use-product` flags, and also does not set a read level cutoff using `-M 0`. This is just an example and may or may not be appropriate given your experiment. See GitHub documentation for details.

Here is an example output:

Run Configuration >> Control Group : ["AAV1", "AAV2", "AAV3"] >> Treatment Group : ["Brain1", "Brain2", "Brain3", "Brain4"] >> Number of sgRNAs : 12313 >> Number of Genes : 2421 >> Normalization Method : MedianRatio >> Aggregation Method : GeoPAGG { token: Some("non-targeting"), weight_config: DropFirst { alpha: 0.50000 }, fdr: 0.10000, use_product: true, zscore_threshold: None } >> P-Value Correction Method : BenjaminiHochberg Filtering Low Count sgRNAs >> Minimum Base Mean : 0.00000 >> Number of Filtered sgRNAs : 0 Modeling Mean Variance >> Removed Outlier sgRNAs : 5 >> Removed Undervaried sgRNAs : 6578 >> Linear Model Type : Wols >> Fit Parameter; K : 0.16455 >> Fit Parameter; B : 1.23204 Performing Differential Abundance >> Sample Aggregation Strategy: CountMedian Performing Gene Aggregation >> Removed Zero sgRNAs : 4 >> NTC Token : "non-targeting" >> FDR : 0.10000 >> Weight Configuration : DropFirst { alpha: 0.50000 } >> Seed : 42 Hits >> Number of Hits : 209 >> Number Upregulated Hits : 0 >> Number Downregulated Hits : 209
This example screen produced 209 hit genes (all with a negative phenotype) using a 0.1 FDR cutoff. It will also write files which detail the hit genes, as well as the phenotype and statistics for all genes and all sgRNAs.

Generate volcano plots and/or scatterplots using `screenviz` or packages of choice:
`screen_viz` lets you quickly and easily generate volcano plots for your screen data, at both the sgRNA and gene level. This is useful for getting a quick peak at your data, but other plotting tools can be used to create more sophisticated plots.
If not done before, install `screenviz` according to instructions on Github: https://github.com/noamteyssier/screenviz.

Example command to open interactive volcano plot generating tool:
screenviz results -n YourExperiment_Brains_vs_AAVs.txt
Example volcano plot showing the results of a survival screen in CaMKII-Cre+ neurons made with R:

Appendix: Sequences for primers and indicies
Custom sequencing primer oIR300:
AB
Primer NameSequence (5'- to 3'-)
oIR300_mirror_SeqPrimerGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC
List of primers used for PCR amplication of sgRNAs:
We use one common forward primer (oMK732) and a variety of reverse (index) primers, which add a unique sample index for each sample.
Common PCR forward primer (used for all samples), does not contain index
AB
Primer NameSequence (5'- to 3'-)
oMK732_HS4Kmirror_CRISPR_revcaagcagaagacggcatacgaGATgcacaaaaggaaactcaccct
Indexing (reverse) primers: Inverted (Use for most mouse screening samples, e.g. episomes from brains injected with pAP215, pIR110, pIR112, etc. and where Cre recombinase was present)
ABCD
Index Long NameIndex Short NameIndex SequenceFull Sequence (5'- to 3'-)
oIR201_mirror_Ms_i1Ms_i1ATCACGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGTGACTGGTACTGACACGTCG
oIR202_mirror_Ms_i2Ms_i2CGATGTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTTGACTGGTACTGACACGTCG
oIR203_mirror_Ms_i3Ms_i3TTAGGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCTGACTGGTACTGACACGTCG
oIR204_mirror_Ms_i4Ms_i4TGACCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCATGACTGGTACTGACACGTCG
oIR205_mirror_Ms_i5Ms_i5ACAGTGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGTGACTGGTACTGACACGTCG
oIR206_mirror_Ms_i6Ms_i6GCCAATaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATTGACTGGTACTGACACGTCG
oIR207_mirror_Ms_i7Ms_i7CAGATCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCTGACTGGTACTGACACGTCG
oIR208_mirror_Ms_i8Ms_i8ACTTGAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGATGACTGGTACTGACACGTCG
oIR209_mirror_Ms_i9Ms_i9GATCAGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGTGACTGGTACTGACACGTCG
oIR210_mirror_Ms_i10Ms_i10TAGCTTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTTGACTGGTACTGACACGTCG
oIR211_mirror_Ms_i11Ms_i11GGCTACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACTGACTGGTACTGACACGTCG
oIR212_mirror_Ms_i12Ms_i12CTTGTAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTATGACTGGTACTGACACGTCG
oIR213_mirror_Ms_i13Ms_i13AGTCAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAATGACTGGTACTGACACGTCG
oIR214_mirror_Ms_i14Ms_i14AGTTCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCTGACTGGTACTGACACGTCG
oIR215_mirror_Ms_i15Ms_i15ATGTCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCATGACTGGTACTGACACGTCG
oIR216_mirror_Ms_i16Ms_i16CCGTCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCTGACTGGTACTGACACGTCG
Not in use--
oIR217_mirror_Ms_i18Ms_i18GTCCGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCTGACTGGTACTGACACGTCG
oIR218_mirror_Ms_i19Ms_i19GTGAAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAATGACTGGTACTGACACGTCG
oIR219_mirror_Ms_i20Ms_i20GTGGCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTGACTGGTACTGACACGTCG
oIR220_mirror_Ms_i21Ms_i21GTTTCGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGTGACTGGTACTGACACGTCG
oIR221_mirror_Ms_i22Ms_i22CGTACGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTGACTGGTACTGACACGTCG
oIR222_mirror_Ms_i23Ms_i23GAGTGGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGTGACTGGTACTGACACGTCG
Not in use--
oIR223_mirror_Ms_i25Ms_i25ACTGATaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATTGACTGGTACTGACACGTCG
Not in use--
oIR224_mirror_Ms_i27Ms_i27ATTCCTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTGACTGGTACTGACACGTCG
Not in use--
Not in use--
Not in use--
Not in use--
Not in use--
oIR225_mirror_Ms_i33Ms_i33ATGTGGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTGGTGACTGGTACTGACACGTCG
oIR226_mirror_Ms_i34Ms_i34CTCAACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCAACTGACTGGTACTGACACGTCG
oIR227_mirror_Ms_i35Ms_i35TCTCCTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCCTTGACTGGTACTGACACGTCG
oIR228_mirror_Ms_i36Ms_i36CGGCTGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTGTGACTGGTACTGACACGTCG
oIR229_mirror_Ms_i37Ms_i37GCCTTTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCTTTTGACTGGTACTGACACGTCG
oIR230_mirror_Ms_i38Ms_i38TACGCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTACGCATGACTGGTACTGACACGTCG
oIR231_mirror_Ms_i39Ms_i39GATATAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATATATGACTGGTACTGACACGTCG
oIR232_mirror_Ms_i40Ms_i40AGAAGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGAAGCTGACTGGTACTGACACGTCG
oIR233_mirror_Ms_i41Ms_i41TCATAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCATAATGACTGGTACTGACACGTCG
oIR234_mirror_Ms_i42Ms_i42CGAGGGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGGGTGACTGGTACTGACACGTCG
oIR235_mirror_Ms_i43Ms_i43ATCGAGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCGAGTGACTGGTACTGACACGTCG
oIR236_mirror_Ms_i44Ms_i44GACACTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGACACTTGACTGGTACTGACACGTCG
oIR237_mirror_Ms_i45Ms_i45CGTATCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTATCTGACTGGTACTGACACGTCG
oIR238_mirror_Ms_i46Ms_i46TAACTCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAACTCTGACTGGTACTGACACGTCG
oIR239_mirror_Ms_i47Ms_i47CTAACTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAACTTGACTGGTACTGACACGTCG
oIR240_mirror_Ms_i48Ms_i48GCGCGAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGCGATGACTGGTACTGACACGTCG
oIR241_mirror_Ms_i49Ms_i49TCAGCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAGCCTGACTGGTACTGACACGTCG
oIR242_mirror_Ms_i50Ms_i50GAAAACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAAAACTGACTGGTACTGACACGTCG
oIR243_mirror_Ms_i51Ms_i51TACCGTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTACCGTTGACTGGTACTGACACGTCG
oIR244_mirror_Ms_i52Ms_i52AGTGTGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTGTGTGACTGGTACTGACACGTCG
oIR245_mirror_Ms_i53Ms_i53CTTTCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTTCCTGACTGGTACTGACACGTCG
oIR246_mirror_Ms_i54Ms_i54AGGCCTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGCCTTGACTGGTACTGACACGTCG
oIR247_mirror_Ms_i55Ms_i55CTGGCGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGGCGTGACTGGTACTGACACGTCG
oIR248_mirror_Ms_i56Ms_i56GCCAAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAAATGACTGGTACTGACACGTCG
oIR249_mirror_Ms_i57Ms_i57ATCAGAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCAGATGACTGGTACTGACACGTCG
oIR250_mirror_Ms_i58Ms_i58TCGGTGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGTGTGACTGGTACTGACACGTCG
oIR251_mirror_Ms_i59Ms_i59CGCTGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTGCTGACTGGTACTGACACGTCG
oIR252_mirror_Ms_i60Ms_i60TCAATTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAATTTGACTGGTACTGACACGTCG
oIR253_mirror_Ms_i61Ms_i61GAACCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAACCATGACTGGTACTGACACGTCG
oIR254_mirror_Ms_i62Ms_i62CGATTTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATTTTGACTGGTACTGACACGTCG
Not in use--
Not in use--
Not in use--
Not in use--
Not in use--
Not in use--
Not in use--
Not in use--
oIR255_mirror_Ms_i71Ms_i71AGCTAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCTAATGACTGGTACTGACACGTCG
oIR256_mirror_Ms_i72Ms_i72TACATGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTACATGTGACTGGTACTGACACGTCG
oIR257_mirror_Ms_i73Ms_i73GCTCTGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTCTGTGACTGGTACTGACACGTCG
oIR258_mirror_Ms_i74Ms_i74TAATCTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATCTTGACTGGTACTGACACGTCG
oIR259_mirror_Ms_i75Ms_i75TAGTTAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGTTATGACTGGTACTGACACGTCG
oIR260_mirror_Ms_i76Ms_i76CTCCCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCCCATGACTGGTACTGACACGTCG
oIR261_mirror_Ms_i77Ms_i77AGCCGGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCCGGTGACTGGTACTGACACGTCG
oIR262_mirror_Ms_i78Ms_i78CTACAGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTACAGTGACTGGTACTGACACGTCG
oIR263_mirror_Ms_i79Ms_i79GAAGGTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAAGGTTGACTGGTACTGACACGTCG
oIR264_mirror_Ms_i80Ms_i80ATGGTTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGGTTTGACTGGTACTGACACGTCG
oIR265_mirror_Ms_i81Ms_i81TATCAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTATCAATGACTGGTACTGACACGTCG
oIR266_mirror_Ms_i82Ms_i82CGTGCTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCTTGACTGGTACTGACACGTCG
oIR267_mirror_Ms_i83Ms_i83GCGATCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGATCTGACTGGTACTGACACGTCG
oIR268_mirror_Ms_i84Ms_i84GCATGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCATGCTGACTGGTACTGACACGTCG
oIR269_mirror_Ms_i85Ms_i85GAGGAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGGAATGACTGGTACTGACACGTCG
oIR270_mirror_Ms_i86Ms_i86ATATACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATATACTGACTGGTACTGACACGTCG
oIR271_mirror_Ms_i87Ms_i87TCGACAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGACATGACTGGTACTGACACGTCG
oIR272_mirror_Ms_i88Ms_i88AGGTTCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGTTCTGACTGGTACTGACACGTCG
oIR273_mirror_Ms_i89Ms_i89CGGAGTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGAGTTGACTGGTACTGACACGTCG
oIR274_mirror_Ms_i90Ms_i90TCCAGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCAGCTGACTGGTACTGACACGTCG
oIR275_mirror_Ms_i91Ms_i91GGGTAGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGGTAGTGACTGGTACTGACACGTCG
oIR276_mirror_Ms_i92Ms_i92AGATCGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGATCGTGACTGGTACTGACACGTCG
oIR277_mirror_Ms_i93Ms_i93GCAGTAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCAGTATGACTGGTACTGACACGTCG
oIR278_mirror_Ms_i94Ms_i94GCCGGGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCGGGTGACTGGTACTGACACGTCG
oIR279_mirror_Ms_i95Ms_i95AGTCACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCACTGACTGGTACTGACACGTCG
oIR280_mirror_Ms_i96Ms_i96CTGTATaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGTATTGACTGGTACTGACACGTCG
We used the index prefix "Ms_" before these index indicators to refer to mouse. However, these are Cre inversion-specific index primers so they can theoretically be used in other species as long as Cre is present to invert the handle sequence in pAP215 or other plasmids using the same targeting strategy.

Indexing Primers: UN-inverted (Use ONLY with AAV reference samples) 
ABCD
Index Long NameIndex Short NameIndex SequenceFull Sequence (5'- to 3'-)
oMK731_HS4Kmirror_CRISPR_index1i1ATCACGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGCGACTCGGTGCCACTTTTTC
oSEQ2_mirror_i2i2CGATGTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTCGACTCGGTGCCACTTTTTC
oSEQ3_mirror_i3i3TTAGGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCCGACTCGGTGCCACTTTTTC
oMK752_HS4Kmirror_CRISPR_index4i4TGACCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCACGACTCGGTGCCACTTTTTC
oSEQ5_mirror_i5i5ACAGTGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGCGACTCGGTGCCACTTTTTC
oMK729_HS4Kmirror_CRISPR_index6i6GCCAATaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATCGACTCGGTGCCACTTTTTC
oSEQ7_mirror_i7i7CAGATCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCCGACTCGGTGCCACTTTTTC
oMK766_HS4Kmirror_CRISPR_index8i8ACTTGAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGACGACTCGGTGCCACTTTTTC
Not in use-
oMK730_HS4Kmirror_CRISPR_index10i10TAGCTTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTCGACTCGGTGCCACTTTTTC
oMK754_HS4Kmirror_CRISPR_index11i11GGCTACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACCGACTCGGTGCCACTTTTTC
oSEQ12_mirror_i12i12CTTGTAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTACGACTCGGTGCCACTTTTTC
oMK750_HS4Kmirror_CRISPR_index13i13AGTCAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACGACTCGGTGCCACTTTTTC
oSEQ14_mirror_i14i14AGTTCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCCGACTCGGTGCCACTTTTTC
oSEQ15_mirror_i15i15ATGTCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCACGACTCGGTGCCACTTTTTC
oSEQ16_mirror_i16i16CCGTCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGACTCGGTGCCACTTTTTC
-Not in use-
oSEQ18_mirror_i18i18GTCCGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCCGACTCGGTGCCACTTTTTC
oSEQ19_mirror_i19i19GTGAAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGACTCGGTGCCACTTTTTC
oSEQ20_mirror_i20i20GTGGCCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCCGACTCGGTGCCACTTTTTC
oSEQ21_mirror_i21i21GTTTCGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGCGACTCGGTGCCACTTTTTC
oSEQ22_mirror_i22i22CGTACGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGCGACTCGGTGCCACTTTTTC
oSEQ23_mirror_i23i23GAGTGGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGCGACTCGGTGCCACTTTTTC
-Not in use-
oSEQ25_mirror_i25i25ACTGATaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATCGACTCGGTGCCACTTTTTC
-Not in use-
oSEQ27_mirror_i27i27ATTCCTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTCGACTCGGTGCCACTTTTTC
oQSEQ7096_mirror_i28i28ACACGCaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACACACGCCGACTCGGTGCCACTTTTTC
oQSEQ7088_mirror_i29i29AGACCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGACCACGACTCGGTGCCACTTTTTC
oQSEQ7080_mirror_i30i30AACAAGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACAAGCGACTCGGTGCCACTTTTTC
oQSEQ7072_mirror_i31i31GTAGAAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAGAACGACTCGGTGCCACTTTTTC
oQSEQ7064_mirror_i32i32CAGGACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGACCGACTCGGTGCCACTTTTTC
Supplementary higher indicies:
oSEQ63_mirror_i63i63TCGCACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCACCGACTCGGTGCCACTTTTTC
oSEQ64_mirror_i64i64GATGCGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATGCGCGACTCGGTGCCACTTTTTC
oSEQ65_mirror_i65i65CTTCTTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTCTTCGACTCGGTGCCACTTTTTC
oSEQ66_mirror_i66i66GACTGAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGACTGACGACTCGGTGCCACTTTTTC
oSEQ67_mirror_i67i67ATAGCAaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGCACGACTCGGTGCCACTTTTTC
oSEQ68_mirror_i68i68CGGGACaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGGACCGACTCGGTGCCACTTTTTC
oSEQ69_mirror_i69i69TGTAAGaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTAAGCGACTCGGTGCCACTTTTTC
oSEQ70_mirror_i70i70GCTAGTaatgatacggcgaccaccgaGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTAGTCGACTCGGTGCCACTTTTTC

Protocol references
• Aurnhammer et al. (2012), Hum Gene Ther Methods. PMID: 22428977.
• Boswell (2020), Protocols.io, DOI: 10.17504/protocols.io.bkppkvmn.
• Grosjean, P. (Jan. 14, 2025). pyguide. GitHub. https://github.com/pgrosjean/pyguide.
• Heo et al. (2024), Genome Biol. PMID: 38243310.
• Horlbeck et al. (2016), eLife. PMID: 27661255.
• Kim et al. (2014), J Vis Exp. PMID: 25286085.
• Negrini et al. (2020) Curr Protoc Neurosci, PMID: 32865885.
• Rose, Ramani, Pan, and Kampmann (2025), Protocols.io. DOI: 10.17504/protocols.io.14egn6ezpl5d/v1.
• Teyssier, N. (Jul. 18, 2024). sgcount. GitHub. https://github.com/noamteyssier/sgcount.
• Teyssier, N. (Jul. 18, 2024). sgcount. Zenodo. DOI: 10.5281/zenodo.12774352.
• Teyssier, N. (Jul. 18, 2024). crispr_screen. GitHub. https://github.com/noamteyssier/crispr_screen.
• Teyssier, N. (Jul. 18, 2024). crispr_screen. Zenodo. DOI: 10.5281/zenodo.12774208.
• Teyssier, N. (Oct. 7, 2024). bootstrap_analysis_invivo_crispr_screen. GitHub. https://github.com/noamteyssier/bootstrap_analysis_invivo_crispr_screen.
• Thermo Fisher Scientific. (March 31, 2025). TRIzol Reagent User Guide. Pub. No. MAN0001271, Rev. D. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/trizol_reagent.pdf.