Jun 11, 2026
Protocol for Bundibugyo ebolavirus qPCR SYBR singleplex assay
- Elyse Stachler1,
- Kyle McMahon1,
- Stella Nielsen1,
- Hannah Knoll1,
- Colby Wilkason1,
- Al Ozonoff1,
- Pardis Sabeti1
- 1Broad Institute of MIT and Harvard
- Diagnostic Assay Protocols
Protocol Citation: Elyse Stachler, Kyle McMahon, Stella Nielsen, Hannah Knoll, Colby Wilkason, Al Ozonoff, Pardis Sabeti 2026. Protocol for Bundibugyo ebolavirus qPCR SYBR singleplex assay. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5w655v1b/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 11, 2026
Last Modified: June 11, 2026
Protocol Integer ID: 318953
Keywords: bundibugyo ebolavirus qpcr sybr singleplex, protocol for bundibugyo ebolavirus qpcr sybr singleplex, bundibugyo ebolavirus, outbreak of bundibugyo ebolavirus, sudan ebolavirus viral rna, sudan ebolavirus viral rna under the condition, zaire ebolavirus, sudan ebolavirus, accessible molecular detection tool for bdbv surveillance, bdbv viral rna, singleplex taqman assay, taqman assay, transcriptase quantitative pcr, whole viral rna, specific bdbv detection, viral rna, assay protocol, assay format, outbreak response, accessible molecular detection tool, bdbv surveillance, assay, quantitative pcr, assay performance, sybr green assay, transcriptase, outbreak, using synthetic rna gene fragment, public health emergency of international concern, qpcr
Abstract
In May 2026, an outbreak of Bundibugyo ebolavirus (BDBV) in the Democratic Republic of the Congo was declared a Public Health Emergency of International Concern by the World Health Organization, underscoring the need for reliable, rapidly deployable diagnostic tools. Here, we present the development and analytical validation of reverse-transcriptase quantitative PCR (RT-qPCR) assays designed for sensitive and specific BDBV detection. We developed and evaluated three assay formats: a singleplex TaqMan assay, a duplex TaqMan assay incorporating a human internal control, and a singleplex SYBR assay to reduce dependence on probe availability during outbreak response. We evaluated assay performance using synthetic RNA gene fragments, whole viral RNA, and contrived clinical samples. Both TaqMan assays achieved a 95% limit of detection (LOD95) of 5 copies/reaction, while the SYBR Green assay achieved an LOD95 of 50 copies/reaction. In addition, the assays accurately detected BDBV viral RNA and did not detect Zaire ebolavirus or Sudan ebolavirus viral RNA under the conditions tested. By making the assay protocols and resources openly available through protocols.io, this assay set provides a flexible and accessible molecular detection tool for BDBV surveillance, research, and outbreak response.
Guidelines
Patient blood/serum/plasma collection and testing for this protocol requires prior approval by the users' Institutional Ethics Board or equivalent ethics committee.
Materials
- Applied Biosystems™ Power SYBR® Green RNA-to-CT™ 1-Step Kit (4391178 or 4389986)
- General lab plastics (qPCR plates, microcentrifuge tubes, etc.)
- Forward and reverse primers:
| Name | Sequence (5' > 3') | Final Assay Concentration (nM) | |
| Bundi_FP | TAACTCATCCACAGACCCCA | 150 | |
| Bundi_RP | GATGGCGCCGAAACTATAGA | 150 | |
| Bundi_gblock | gaaatTAATACGACTCACTATAgggTACCTAACCTACACGTCTACGCTTTCCTTGGATCTCACAAGGTACCGAGAGAATGAGTTAATTTATGATAACAATCCGTTAAAAGGTGGACTTAATTGCAACCTATCCTTTGATAATCCACTTTTCAAGGGCCAAAGGCTCAATATCATAGAGGAGGATTTGATTAGATTTCCTCATCTATCTGGGTGGGAACTTGCGAAAACCATCATTCAGTCCATTATCTCAGACAGCAATAACTCATCCACAGACCCCATTAGCAGTGGAGAAACACGATCATTCACAACTCACTTTCTCACATATCCTAAGGTTGGGCTCCTCTATAGTTTCGGCGCCATCGTGAGTTATTACTTAGGGAATACCATTATTAGGACCAAAAAGCTAGACCTCAGTCATTTTATGTATTACTTAACAACTCAAATCCATAATTTGCCACATCGCTCGTTGAGGATACTTAAGCCCACCTTTAAACATGTTAGTGTGATATCAAGACTAATGAGTAT | - |
Before start
- Any One-Step RT-qPCR SYBR Green kit should be compatible with the below protocol. If using a different kit than the one listed, be sure to first validate a standard curve before running patient samples. The protocol/cycling conditions may need to be updated to be compatible with the available kit.
- This protocol requires nucleic acid extraction from plasma prior to running the qPCR. While the protocol is validated for extracted plasma, extraction from whole blood or serum will likely be compatible. A test to check for PCR inhibition should be done before using a sample matrix other than plasma.
Protocol
Thaw qPCR mastermix and primers at room temperature. After components are thawed, briefly mix by inversion or gentle vortexing. Briefly centrifuge or flick the tube to collect liquid at the bottom before opening the tubes.
Prepare 10µM stocks of the forward primer and reverse primer.
Prepare a mastermix according to the table below. The table accounts for plating triplicate 10µL reactions per sample and includes overage. If running a standard curve, ensure these are included in the sample count. Minimally, run a positive control and a no template control (NTC) per plate.
| A | B | C | D | |
| Component | 30µL rxn | Overage | Total to make (for 8 rxns) | |
| Power SYBR Green RT-PCR Mix (2✕) | 15.00 | 18.00 | 172.80 | |
| RT Enzyme Mix (125✕) | 0.24 | 0.29 | 2.76 | |
| Forward primer (10µM) | 0.45 | 0.54 | 5.18 | |
| Reverse primer (10µM) | 0.45 | 0.54 | 5.18 | |
| Template RNA | 3.00 | 3.60 | - | |
| Nuclease-free Water | 10.86 | 13.03 | 125.11 | |
| TOTAL: | 30.00 | 36.00 | 311.04 |
Gently mix mastermix and spin down to ensure uniformity. Aliquot 32.4µL of mastermix per well in a 96-well plate according to the number of samples being run.
Pipette 3.6µL of extracted plasma (or positive control material or water for an NTC).
Gently vortex plate and spin down.
Pipette triplicate 10µL reactions into a 96-well or 384-well plate. Seal plate with an optical seal compatible with the qPCR machine being used.
Briefly spin plate to collect liquid at the bottom.
Program the qPCR machine according to the following:
Reaction volume: 10µL
Fluorophore: SYBR
Passive dye: rox
Ensure there is a plate read step at the end of each extension cycle
Cycling conditions:
| Stage | Step | Temperature (ºC) | Time | Cycles | |
| Holding | Reverse transcription | 48 | 30 min | 1 | |
| Holding | Activation of AmpliTaq Gold‱ DNA Polymerase, UP (Ultra Pure) | 95 | 10 min | 1 | |
| Cycling | Denature | 95 | 15 sec | 40 | |
| Anneal/Extend | 60 | 1 min | |||
| Melt curve (optional) | Denature | 95 | 15 sec | 1 | |
| Anneal | 60 | 15 sec | 1 | ||
| Denature | 95 | 15 sec | 1 |