Mar 14, 2023
  • FishFloorUCL 1
  • 1University College London
  • FishFloorUCL
Icon indicating open access to content
QR code linking to this content
Protocol CitationFishFloorUCL 2023. Prepare Samples for Miseq. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbyknyvpk/v2Version created by Talia Pittman
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 14, 2023
Last Modified: March 22, 2023
Protocol Integer ID: 78766
Keywords: miseq, sequencing, dna sequence multiple sample, fish with mosaic genotype, samples for miseq, miseq nano v2 chip 300 cycle, miseq multiplexes sequence, genotyping fish, miseq nano v2 chip, dna sequence, mosaic genotype, multiple sample, dna, genotype, miseq, sample
Abstract
(MiSeq nano V2 chip 300 cycle), MiSeq multiplexes sequences, allowing you to DNA sequence multiple samples at once. This is particularly useful for genotyping fish with mosaic genotypes, such as F0 knockouts.

@FishFloorUCL
Protocol materials
ExoSAP-IT™ PCR Product Cleanup ReagentThermo FisherCatalog #78201.1.ML
Qubit™ 1X dsDNA High Sensitivity (HS) Assay KitInvitrogen - Thermo FisherCatalog #Q33231
Design Miseq Primers
Design primers surrounding your site of interest

  • Optimal amplicon size 200bp
  • As far as possible, the site of interest should be in the middle of the designed amplicon. (This is so that it has the best chance of being read by both the forward and reverse reads)
  • If possible, try and avoid designing primers in non-coding regions of DNA since these regions are more likely to have variation and SNPs, which might affect the efficacy of your primer.

I usually use the NCBI Primer-Blast tool. Enter ~300bp of DNA sequence around your region of interest under 'PCR Template' and set the 'Range' for the forward and reverse primer so that your site of interest is more or less in the middle of the PCR product.

If you previously used a set of primers to check your TALLEN/CRISPR efficiency using Melt Curve Analysis, or if you have your primer sequence from CHOPCHOP, you can use the same sequence to design the primers for MiSeq. Anecdotally this seems to work well for most people on their first try.
Add miseq tags/overhangs to your primer sequence.

  • Universal forward (F) tag: 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3'
  • Universal reverse (R) tag: 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3'


These overhang sequences correspond to the Illumina nextera transposase overhangs and will be compatible with Illumina kits using Nextera XT
(Optional) Test primers (including tag) for secondary structure formation (e.g., dimers and hairpins) using this online IDT OligoAnalyzer tool

NB. It is unlikely that you will have high scores due to the length of the primers and amplicon restrictions. Just pick the best
Order primers - standard desalted primers are fine for this application.
If the primers arrive as dry pellets, reconstitute the primers in autoclaved distilled or nuclease-free water to create a stock solution and working solution.
  • 100 micromolar (µM) stock solution by adding nuclease-free water. If nMoles of your primer (check the tube), resuspend the dry pellet in µL of water
  • 10 micromolar (µM) working solution
(Optional) Test Primers
11m 30s

Note
Testing your primers is optional. Although, it is recommended, especially if you are having trouble getting your PCR to work or if you have a lot of samples and want to ensure your primers work before running the entire experiment.

For optimal Miseq results, it is best to use a high-fidelity polymerase. However, at this stage, you can use a cheaper polymerase. Feel free to use a DNA polymerase and PCR protocol that works for you and follow the instructions with the kit. I usually use standard Taq DNA Polymerase.
Taq DNA Polymerase recombinantInvitrogen - Thermo FisherCatalog #10342


Run a PCR
I have designed a handy master mix calculator for Taq, Platinum Taq and Pre-mix Schier PCR mix.
Here is an example of a PCR mix for a single well with a 10 µL total volume
AB
Autoclaved, distilled (nuclease free) water 6.46 μL
10X PCR Buffer, -Mg 1 μL
50 mM MgCl2 0.3 μL
10 mM (each) dNTP Mix 0.2 μL
10 μM forward primer 0.5 μL
10 μM reverse primer 0.5 μL
Taq DNA Polymerase 0.04 μL
Template DNA (from 100μL HotShot) 1 μL
Note, Taq is unstable and should be taken out of the freezer for the shortest amount of time possible. It is sensible to prepare PCR mix on ice.

Suggested PCR programme:
  1. 95 °C , 00:05:00
  2. 95 °C , 00:00:30 (Denaturation step)
  3. Temperature gradient* around 60 °C , 00:00:30 (Annealing step)
  4. 72 °C , 00:00:30 (Extension step)
  5. Repeat steps 2-4, 25-35 times
  6. 72 °C , 00:05:00 (Final extension step)
  7. 10 °C hold

*For your test run, you should use a gradient PCR to test the ideal temperature for your primers (Note. By default, CHOPCHOP designs primers for an optimal melting temperature of 60°C). We usually run a gradient PCR for five different temperatures, with 60°C being optimal, then varying 1°C-1.5°C above and below.
11m 30s
Run on a 1% agarose gel
Expected result
Assuming a 200bp amplicon, you should expect a final PCR product of 267bp on your gel. If you don't see a band in the expected region, you may need to re-design your primers.

Prepare samples for miseq
11m 30s
Amplify up PCR products to analyse by MiSeq.

Note
Important Note! You can only submit up to 96 samples per amplicon on one MiSeq run. During the miseq process, all samples are pooled into one plate; you will only be able to distinguish between samples from the same well in different plates if their amplicons are in a different region of the genome (Basically don’t do Fish1_Guide1 in Plate 1 well B2 & Fish2_Guide1 in Plate 2 well B2 because they will be indistinguishable).

We recommend using a high-fidelity Taq polymerase. We recommend using Taq DNA Polymerase PlatinumInvitrogen - Thermo Fisher or Phusion® High-Fidelity DNA Polymerase from New England Biolabs (M0530), but any high-fidelity polymerase will do.

I have designed a handy master mix calculator.
Here is an example of a PCR mix for a single well with 10 µL total volume
AB
Autoclaved, distilled (or nuclease free) water7 μL
10X PCR Buffer, -Mg1 μL
50 mM MgCl20.3 μL
10 mM (each) dNTP Mix0.2 μL
10 μM forward primer0.2 μL
10 μM reverse primer0.2 μL
Platinium Taq DNA Polymerase0.1 μL
Template DNA1 μL
Note, Taq is unstable and should be taken out of the freezer for the shortest amount of time possible. It is sensible to prepare PCR mix on ice.

Suggested PCR programme:
  1. 95 °C , 00:05:00 (Initial Denaturation Step)
  2. 95 °C , 00:00:30 (Denaturation step)
  3. 60 °C * 00:00:30 (Annealing step)
  4. 72 °C , 00:00:30 (Extension step)
  5. Repeat steps 2-4, 25-35 times
  6. 72 °C , 00:05:00 (Final extension step)
  7. 10 °C hold

*Or Tm of your given primer pair
11m 30s
Run on a 1% gel to confirm a single band at the anticipated weight. This is just to check the PCR worked. To save time, just run a couple of your samples.
Clean up your samples

Traditional column-based PCR clean-up kits would work fine, but we recommend using ExoSAP, ExoSAP-IT™ PCR Product Cleanup ReagentThermo FisherCatalog #78201.1.ML . Although it is more expensive (~£30 per plate), it is much more practical, especially for many samples.

  1. Transfer 5 µL of your PCR product into a new plate
  2. Add 2 µL of ExoSAP reagent to each well
  3. (Vortex optional) Spin down & run the ExoSAP programme thermocycler.
  • 00:15:00 at 37 °C – Degrade the remaining primers and nucleotides
  • 00:15:00 at 80 °C – Inactivate ExoSAP
30m
Check the concentration of your clean PCR product. This can be done using Nanodrop or Qubit. I would recommend Qubit due to its superior accuracy and reliability. We recommend only testing a few of your samples to save time and money.

We usually use the following kit from Thermo Fisher, which comes with a working solution.
Qubit™ 1X dsDNA High Sensitivity (HS) Assay KitInvitrogen - Thermo FisherCatalog #Q33231

Setup and label the lids of the required number of assay tubes for your samples plus two standards (Use thin-wall, clear, 0.5-mL Qubit Assay PCR tubes (Cat. No. Q32856)).
  1. Add 190 µL Qubit™ 1X dsDNA working solution to each standard tube
  2. Add 10 µL of each Qubit standard to the appropriate standard tube
  3. Add 199 µL Qubit™ 1X dsDNA working solution to each sample tube
  4. Add 1 µL of each sample to the appropriate tube
All tubes should have a final volume of 200 µL


Read concentration using the Qubit machine and note them down.
Prepare your samples for miseq:
You need to submit a minimum of 6 µL at a final concentration of 15-25 ng/μL
Label your plate/tubes with your name, the date and 'For Miseq' and leave the samples with the Payne lab in the Cancer Insititute or in the Fish Facility B03 fridge in the anatomy building, whichever is most convenient for you. Once you have dropped off your samples, email Alexandra Lubin, letting her know.


Note
You could save time and plastic by combining clean-up with dilution to 15-25 ng/μL.

Step 1: Measure the concentration of the PCR product before clean-up

Step 2: In a new plate/tubes, add your PCR product, ExoSAP and nuclease-free water (if necessary). Volumes will differ according to the concentration of your samples. Calculate how much you need to dilute your PCR product according to the concentration you measured. Add 2 µL ExoSAP for every 5 µL you add of your PCR product and top up with nuclease-free water where needed. The following table shows some examples:
ABCD
ConcentrationPCR prodoct (vol)ExoSAP (vol)nuclease-free water (vol)
< 15-25 ng/μL 5 μL2 μL0 μL
30-50 ng/μL5 μL2 μL3 μL
45-75 ng/μL2.5 μL1 μL~6 μL

Step 3: (Vortex optional) Spin down & run the ExoSAP programme thermocycler.
  • 00:15:00 at 37 °C – Degrade the remaining primers and nucleotides
  • 00:15:00 at 80 °C – Inactivate ExoSAP

The resulting plate/tubes will be ready to submit for miseq.