Mar 09, 2026
Preparation, Performance, and Interpretation of the African Swine Fever rtPCR Assay on the Applied Biosystems™ QuantStudio 5 Real-time PCR System
- Nathaniel Higdon1,2,
- Leslie Blakemore1,
- Kate Schumann1,
- Rachel Palinski1,
- Robin Holland1,
- Suelee Robbe-Austerman1
- 1Diagnostics and Biologics, National Veterinary Services Laboratories, Animal Plant Health Inspection Service, United States Department of Agriculture;
- 2Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University of Science and Technology
- USDA APHIS NVSL
Protocol Citation: Nathaniel Higdon, Leslie Blakemore, Kate Schumann, Rachel Palinski, Robin Holland, Suelee Robbe-Austerman 2026. Preparation, Performance, and Interpretation of the African Swine Fever rtPCR Assay on the Applied Biosystems™ QuantStudio 5 Real-time PCR System. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gp13ydgzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 15, 2026
Last Modified: March 09, 2026
Protocol Integer ID: 238713
Keywords: African Swine Fever Virus (ASFV), real-time PCR (rtPCR), QuantStudio™ 5, TaqMan™ chemistry, TaqMan® Fast Virus, VetMAX™ Fast Multiplex Master Mix, UltraPlex® 1-Step ToughMix®, Veterinary Diagnostics, Xeno™ RNA, Molecular Diagnostics, Transboundary Animal Diseases, african swine fever rtpcr assay, interpretation of the african swine fever rtpcr assay, assay for african swine fever virus, african swine fever virus, successful execution of this assay, rtpcr, pcr inhibition, laboratory flexibility three commercial mastermix option, pcr inhibition an exogenous internal extraction control, time pcr system, diagnostic testing, vetmax, assay, laboratory flexibility, applied biosystem
Disclaimer
This protocol is provided for informational, diagnostic, and research purposes only. The USDA does not endorse any specific method, company, product, or reagent. It is not intended to supersede or serve as official USDA or U.S. Government determination or policy, nor to replace institutional SOPs or regulatory requirements. The workflow described was developed using the Applied Biosystems™ QuantStudio™ 5 platform, TaqMan™ chemistry, and associated reagents; however, equivalent kits or instruments may be used with appropriate validation. Users are responsible for ensuring compliance with all applicable biosafety, quality assurance, and regulatory guidelines. The authors make no representations that this document is complete, accurate, or error-free and assume no responsibility for any errors, omissions, damage, or loss resulting from its use, even if the protocol is followed as written.
Abstract
Described within this protocol are the preparation, performance, and interpretation of a real-time polymerase chain reaction (rtPCR) assay for African Swine Fever Virus (ASFV) surveillance and diagnostic testing using the Applied Biosystems™ QuantStudio™ 5 (ABI QS 5) platform and TaqMan™ chemistry. To monitor extraction efficiency and PCR inhibition an exogenous internal extraction control (Xeno™ RNA) is incorporated. Successful execution of this assay is expected to produce sigmoidal amplification curves with Ct's below 40 for valid controls and positive samples. To better increase laboratory flexibility three commercial mastermix options are presented: VetMAX™ Fast Multiplex Master Mix (with ROX) and UltraPlex® 1-Step ToughMix® Low ROX™ (4X) and TaqMan® Fast Virus 1-Step Master Mix.
Attachments
PAC Paper.pdf
767KB
Guidelines
**Definitions**
- Internal extraction control (IEC): Within this protocol, the exogenous internal positive control used is Xeno™. The Xeno‱ RNA is not added during the PCR process but is added to the lysis/binding buffer step prior to nucleic acid purification; therefore, all extracted samples will contain Xeno™ RNA. It is used to confirm that the extraction process was successful and that PCR inhibition is absent. Detection is confirmed with Xeno™ LIZ assay reagent via the LIZ fluorophore identified using the Cy5 channel.
- Extraction control: A dedicated control sample, composed of nuclease-free water, processed alongside test samples through the entire extraction workflow. This single well serves a dual purpose for the extraction phase. Successful performance of this control indicates that neither contamination (for ASF) nor inhibition (for Xeno) occurred during the nucleic acid purification process.
- Negative Extraction Control (NEC): For the disease target, ASFV. It must produce an undetermined Ct value.
- Positive Extraction Control: For the internal extraction control (IEC), Xeno™. It must produce a Ct value within a pre-defined range.
- No template control (NTC): Consisting of only nuclease-free water and master mix, the successful performance of this control indicates that contamination did not occur during the PCR setup. Because this well does not undergo the extraction process, it contains no Xeno™ or ASF template; therefore, the Ct value must be undetermined for all detectors.
- Positive amplification control (PAC): This control confirms that the PCR reaction reagents were properly prepared and the amplification chemistry is functional for the disease target. The PAC well contains the ASF-PAC template only.
- ASF-PAC: A non-pathogenic bacteriophage Qβ based real-time RT-PCR (qRT-PCR) petits ruminants virus (PPRV) synthetic template positive control ordered via Foreign Animal Disease Diagnostics Laboratory (FADDL) or National Centers for Animal Health (NCAH) user portal. Confirms amplification chemistry is working. The Ct value must fall within a pre-defined range for the FAM fluorophore. Because this is a PCR-only control, it is not expected to be positive for the Xeno™ (IEC) target.
| Control Well | Control Phase | Control Type/Function | Target | Expected Result | |
| Extraction Control | Extraction | Negative | ASFV (FAM) | Undetermined | |
| Positive | Xeno™ (Cy5) | Positive | |||
| NTC | PCR | Negative | ASFV (FAM) & Xeno™ (Cy5) | Undetermined | |
| PAC | Positive | ASFV (FAM) | Positive |
Table 9: Expected Ct results and fluorophore detection for ASFV assay controls. The No Template Control (NTC) monitors PCR setup, the Extraction Control validates the purification process and identifies inhibition via Xeno™, and the Positive Amplification Control (PAC) validates the ASFV-specific PCR reagents.
- Quality critical reagents and supplies: Supplies and reagents that must be purchased from the listed vendor or manufacturer to meet the requirements for quality assurance and quality control.
**Personnel qualifications**
- Personnel performing PCR procedures must be familiar with the preparation and proper handling of samples and reagents. Personnel must also be aware of the calibration, maintenance, and use of instruments included in this protocol.
- For official diagnostic and reporting purposes personnel must have successfully completed and maintained proficiency testing for the detection of ASF.
**Contamination prevention**
- Laboratory gloves should be worn throughout the procedure and changed frequently if contamination of gloves or work area is suspected or when moving between laboratory areas. The use of gloves can help protect reagents and samples from contaminating agents/samples and/or cross-contamination which can affect results.
- Designated laboratory coats should be assigned for “clean” areas and “dirty” areas and connecting lab area. The same lab coat should not be worn for all areas.
**Areas and equipment**
- Under traditional guidance having separate preparation areas and equipment for nucleic acid extraction, reagent preparation, and amplification procedure can be beneficial. Thus, it is beneficial to have three separate areas for the complete PCR procedure.
- One area designated as a "clean" area and used for the preparation of reagents. Within the clean area there should be a biological safety cabinet (BSC) or flow hood prep station designated for clean work only. The clean area is separated from the other area, ideally in a separate room and not just a separate BSC or flow hood. Virus, diagnostic samples, PCR amplicon, or template nucleic acid should never be introduced into the clean area. A designated "clean" set of calibrated pipettes and tips, nuclease-free water, tubes for reagent preparation, racks, and an ice container/cold block, for clean use only and should never leave this area. Exception being the pipettes when undergoing calibration.
- The second area should have a BSC or at a minimum the first area should have a separate PCR hood used only as a PCR prep station. There should be a designated set of pipettes and other equipment and reagents to be used only for this hood. The PCR prep station in this room/area is used for template addition only.
- The third area is used for PCR amplification only. This area contains the equipment to run the rPCR assay, which may include a centrifuge for spinning plates, a waste receptacle for used plates and the ABI QS 5 PCR platform. Equipment and supplies should not be relocated from this room and are considered contaminated.
**Preparation of equipment/ instrumentation**
Disinfection of equipment
- Disinfection of equipment must be performed prior to beginning the extraction procedure and after performing the extraction process. Working areas should be sprayed/wiped with appropriate disinfectants, such as 10% bleach, commercial bleach wipes, Virkon® S, 70% Ethanol, or appropriate cleaning agent for sample and or pathogen being handled. Appropriate contact time for disinfectant should be used and then area should be wiped clean prior to placing sample(s) or reagents in the hood. Should the disinfectant be corrosive, hazardous, etc. a followed up 70% ethanol spray and wipe may be performed to remove any residues. Additionally, appropriate nucleases/DNases/RNases treatment may be performed to the working surfaces and pipettes to further reduce possible contamination from occurring.
Calibration of equipment
- Calibration of all equipment must be completed and certified according to the manufacturer’s instructions and/or the respective institution’s SOP.
- The ABI QS 5 PCR platform must be calibrated for FAM, Cy5, and ROX to perform this SOP. Refer to the manufacturer’s instructions for the proper calibration of this PCR platform.
**Reporting test results**
- Identification of select agents requires reporting to the appropriate select agent office as per current regulations.
- Positive Result:
- Negative Result:
- Inconclusive Result:
Surveillance testing
- Labs performing surveillance testing should report all POSITIVE or INCONCLUSIVE test results immediately to the Diagnostic Services Section (DSS) head at FADDL or their designee at 631-488-7245 or 631-323-3256 or 631-323-3256. If no response: cell phone 631-375-5314. Further the NAHLN coordinator at [email protected], 515-337-7911 or 515-337-7362 (office), or 515-231-2515 or 515-708-0059 (cell) should be contacted. Copies of the real-time PCR results and archived data files must be emailed to the FAD Submissions email box at [email protected].
- Original sample, extracted nucleic acid, and PCR amplicon should be shipped to FADDL for further testing per instructions provided by the DSS head, or representative.
Proficiency testing
- When proficiency testing is being performed all results whether NEGATIVE, POSITIVE, or INCONCLUSIVE should be reported to FADDL in the appropriate proficiency test results collection system.
- Upon completion of proficiency testing all samples should be destroyed per the instructions outlined in the reagent data sheet provided with the panel shipment.
Within FADDL Testing
- For FADDL testing of analytical or diagnostic samples, a POSITIVE or INCONCLUSIVE test result should be reported to the appropriate section head.
**Quality control documentation**
Test performed outside of FADDL: Record QC data (IEC and PAC Ct values) according to your respective institution’s guidelines. Acceptable ranges for the IEC and PAC controls may be provided by FADDL or established by your respective institution. The QC Data is reviewed for trends as it is documented. Consult a supervisor if a trend is detected.
Test performed at FADDL: Record Quality Control (QC) data (IEC and PAC Ct values) in the appropriate PCR Control QC Summary Sheet. Acceptable Ct ranges for each control are evaluated based on QC and test data and are outlined in the appropriate control tracking spreadsheet. The data is reviewed for trends signifying control degradation as it is entered into the spreadsheet. The initials of the person entering the data must be entered into the spreadsheet indicating the data was reviewed. Consult a supervisor if a trend is detected.
Materials
**Reagents**
- Nuclease-free water (50 mL, Thermo Fisher Scientific, catalog No. AM9937 or equivalent)
- Tris-EDTA (TE) buffer, 1x, pH 8.0, suggested reagent
- Positive amplification control (PAC) for ASF, a non-pathogenic bacteriophage Qβ based real-time RT-PCR (qRT-PCR) petits ruminants virus (PPRV) synthetic template positive control (Can be ordered via Foreign Animal Disease Diagnostics Laboratory (FADDL) or National Centers for Animal Health (NCAH) user portal)
- Extraction control serves as both the NEC for ASF and the PEC for the IEC (Xeno™). In this protocol, nuclease free water serves as an extraction control
- VetMAX™ Xeno™ Internal Positive Control - LIZ™ Assay (Thermo Fisher Scientific catalog No. A29766 or A29768)
Note(s):
- Follow reagent expiration dates for the Xeno™ LIZ Reagent. Xeno™ LIZ Internal control reagent is purchased from Thermo Fisher Scientific as a mix and is provided as a working stock. No manipulations or dilutions need to be made. Sequences for this reagent are proprietary and are not available to the consumer. There is no calibration standard for the LIZ reporter, rather, the LIZ reporter is detected through the Cy5 channel.
- VetMAX™ Xeno™ Internal Positive Control RNA (10,000 copies/µL) (Thermo Fisher Scientific catalog No. A29761 or A29763)
- Master mix may be any of the following three options (a quality critical reagent):
1. TaqMan® Fast Virus 1-Step Master Mix (Thermo Fisher Scientific catalog No. 4444432, 4444434, or 4444436)
- AmpliTaq® Fast DNA Polymerase
- dNTPs including dATP, dGTP, dCTP, and dTTP
- RNaseOUT™ Recombinant Ribonuclease Inhibitor
- ROX™ passive reference dye
2. VetMAX™ Fast Multiplex Master Mix (with ROX™) (Thermo Fisher Scientific catalog No. A57081, A57305, or A57306)
- Concentrated M-MLV RT
- Concentrated ultra-pure hot-start DNA polymerase
- Fast-cycling optimized 2X RT-PCR buffer
- Invitrogen ROX™ dye
3. UltraPlex 1-Step ToughMix™ Low ROX™ (4X) (Quantabio catalog No. 95168 - 100, 95168 -500, 95168 – 01K, or 95168 – 10K)
- dATP, dGTP, dCTP, and dTTP
- Magnesium chloride
- qScript™ XLT reverse transcriptase
- RNase inhibitor protein
- AccuStart II Hot-start DNA polymerase
- ROX™ reference dye
Primers and probes, quality critical reagents
- Primers and Probe sequence(s) are listed in Table 1 (must be purchased through reputable source such as Thermo Fisher Scientific or equivalent)
Note(s):
- Primers must be tested every 12 months and meet all quality assurance/ quality control (QA/QC) standards as defined by your respective institution’s guidelines (see Interpretation of the assay). Primers may continue to be used if they meet all QA/QC standards.
- QA/QC testing can include reference panel testing and/or monitoring assay performance using control results (PAC, PEC, and/or IEC). PAC, PEC, and IEC values must fall within the currently accepted range provided to your laboratory or according to your respective institution’s guidelines.
- Probes must be tested and meet all QA/QC requirements (see Interpretation of the assay)
- Probes must be tested every 12 months and meet all QA/QC standards as defined by your respective institution’s guidelines (see Interpretation of the assay). Probes may continue to be used if they meet all QA/QC standards.
- QA/QC testing can include reference panel testing, tracking changes in background fluorescence, and/or monitoring assay performance using controls results (PAC, PEC, and/or IEC). PAC, PEC, and IEC values must fall within the currently accepted range provided to your laboratory or according to the respective institution’s guidelines.
| Oligo Type | Sequence | |
| Forward Primer | 5’- CTTCGGCGAGCGCTTTATCAC -3’ | |
| Revers Primer | 5’- GGAAATTCATTCACCAAATCCTT -3’ | |
| Probe | 6FAM- CGATGCAAGCTTTAT -MGB/NFQ |
Table 10: African Swine Fever Virus (ASFV) Primer and Probe Sequences
**Supplies**
- Pipette tips, aerosol-resistant, nuclease-free
- Assorted microcentrifuge tube racks
- Sterile reagent reservoirs
- MicroAmp™ Fast Optical 96-well Reaction Plate 0.1 mL (Thermo Fisher Scientific catalog No. 4346907)
- MicroAmp™ Adhesive Film Applicator (Applied Biosystems catalog No. 4333183 or equivalent)
- Microcentrifuge tubes, 1.5 mL, nuclease-free
- Laboratory gloves, powder-free
**Equipment**
- Class II biological safety cabinets (BSC)
- Centrifuge capable of holding 96-well plates
- QuantStudio™ 5 System (96-well, Fast, 0.1 mL block) from Applied Biosystems*, part of Thermo Fisher Scientific, calibrated according to recommended manufacturer schedule with computer and software
- The Quant Studio™ 5 real-time PCR platform must be calibrated for FAM, Cy5, and ROX to perform this protocol
- 96-well aluminum cold block, ice and ice bucket, or equivalent
- Pipettes
- Vortex touch mixer or equivalent
- Microcentrifuge
- Cold storage devices/containers
- Ultra-low freezer (i.e., −70 ± 10°C, −80 ± 10°C)
- Freezer (i.e., −20 ± 5°C, −30 ± 5°C)
Note(s):
- Temperature ranges listed for cold storage devices are assumed when listed as a single temperature in the document
Troubleshooting
Before start
Prior to beginning the ASF real-time PCR assay, ensure that all pertinent information is documented for traceability and quality assurance. This may include but is not limited to recording sample identifiers, control positions, reagent lot numbers and expiration dates, etc. Utilize the appropriate ASF rtPCR worksheet (African Swine Fever Real-Time PCR Assay on the Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System Using the Applied Biosystems™ TaqMan™ FAST Virus 1-Step Master Mix) to assist in accurate recordkeeping. Proper annotation supports ISO accreditation, troubleshooting, and compliance with laboratory quality standards. Confirm that all required reagents, controls, and equipment are available and are calibrated before proceeding.
Preparation
Preparation of all Working Stocks for Probe, Primers, Primer/Probe Mix, and MasterMix
Preparation of Working Stock Probe:
- After receipt of any probe(s), they should be stored at -20 °C until the working stock solution has been prepared.
- All probes must be QA/QC tested prior to use and have Ct values which fall within a pre-determined range to ensure proper performance of the reagent. All testing data must be recorded and reagents which do not fall within the specified ranges must be reordered and retested.
- Received concentration of probes are usually 100 µM. To avoid freeze thaw degradation and prolong probe life create 5 µL aliquots. After aliquoting store probes in the freezer in a dark container until ready to use. Ensure proper labeling of tubes and box.
- As needed, prepare a working stock dilution of the probe. To do so make a 1:10 dilution of the probe with nuclease-free water (or equivalent) to each individual aliquot for a final probe concentration of 10 µM (i.e. add 45 µL of nuclease-free water to 5 µL probe). For longer term storage, it is suggested to dilute the probes in 1x TE buffer (pH 8.0).
Preparation of Working Stock Primers:
- While the USDA does not endorse or recommend any specific company it is suggested that the primers be ordered from a reputable company (i.e. Thermo Fisher Scientific). Primers must be QA/QC tested prior to use. Ct values shall fall withing pre-determined range to ensure proper performance of the reagents. All data must be recorded and reagents that do not fall within the specified ranges must be reordered and retested (see Interpretation of the assay section).
- Primers can be stored at a higher stock concentration and should be stored at -20 °C. If primers are stored at higher concentrations, ensure that proper working stock dilutions are made before use in the rtPCR.
- To prepare of 20 µM working stock dilution for the real-time assay using the Applied Biosystems QuantStudio™ 5, dilute the primers by adding the appropriate amount of nuclease-free water or 1x TE buffer as described below.
Table 1: Example for preparing 20 µM working stock primers and conversion information.
- Aliquot working stock dilution (20 µM) primers and store at -20 °C.
Preparation of Primer/Probe Mix:
Note: This step is at the discretion of the researcher and is optional.
- If preparing ASFV primer/probe mix stocks ahead of time for later use combine the appropriate volume of the 20 µM primers and 10 µM probe into one tube. For the "ASFV Reagent Mix" combine 0.375 µL of each primer and 0.5 µL FAM probe per reaction (i.e. for 100 reactions you will combine 37.5 µL of each primer and 50 µL FAM probe).
- Aliquot dilute working stock primer/probe mixes and store at -20 °C until ready to use.
Note: Xeno™ LIZ internal control reagent is purchased from Thermo Fisher Scientific as a mix and is provided as a working stock. No Manipulations or dilutions are needed!
Preparation of MasterMix:
Note(s):
- If the samples were extracted using the DNeasy Blood and Tissue Kit (low throughput method), prepare the master mix according to Table 2 (no internal extraction control).
- If the samples were extracted using a 96-well magnetic bead-based kit (high throughput method), prepare the mastermix according to Table 3 (includes the internal extraction control).
- The final columns in Tables 2 and 3 provide the volumes needed per reaction/well.
- If using the TaqMan® Fast Virus 1-Step Master Mix or UltraPlex® 1-Step ToughMix® Low ROX™ (4X) refer to Tables 2 and 3 for necessary volumes.
- If using VetMAX™ Fast Multiplex Master Mix (with ROX) refer to Tables 4 and 5 for necessary volumes.
- If you are using ASFV primer/probe mx, use the equivalent of 1.25 µL mix per reaction.
DNeasy Blood and Tissue Kit (low throughput method, no internal extraction control)
Refer to ASF rtPCR worksheets for automatic master mix calculations based on desired number of reactions.
African Swine Fever Real-Time PCR Assay on the Applied Biosystems QuantStudio 5 Real-Time PCR System Using the Applied Biosystems TaqMan FAST Virus 1-Step Master Mix Worksheet.docx50KB African Swine Fever real-time PCR Assay on the Applied Biosystems QuantStudio 5 Real-Time PCR System Using the Quantabio UltraPlex 1-Step ToughMix Low ROX 4X Worksheet.docx39KB Remove the selected commercial mastermix from the kit stored at -20 °C and allow to thaw within the BSC/hood. Once thawed, keep all reagents chilled.
Vortex the selected commercial mastermix reagents briefly, then centrifuge at room temperature in a microcentrifuge to bring the contents to the bottom of the tube before adding to the mastermix. Vortex the mastermix briefly.
Centrifuge the mastermix briefly in a microcentrifuge to bring the contents to the bottom of the tube. Place mastermix on ice or cold block until ready to use.
While the mastermix can be stored for up to one week in the freezer, it is ideally made fresh for each run.
| Reagent/Solution Mix | Initial Concentration | Final Concentration | Volume/RXN (µL) | ||
| Nuclease-Free Water | N/A | N/A | 12.5 | ||
| Commercial MasterMix (TaqMan® Fast Virus or UltraPlex 1-Step ToughMix®) | 4x | 1x | 6.25 | ||
| ASF Forward Primer | 20 µM | 0.3 µM | 0.375 | 1.25 | |
| ASF Reverse Primer | 20 µM | 0.3 µM | 0.375 | ||
| ASF Probe (FAM/MGB) | 10 µM | 0.2 µM | 0.5 | ||
| Total Volume | 20 | ||||
Table 2: MasterMix for the ASFV rtPCR assay using TaqMan® Fast Virus or UltraPlex® 1-Step ToughMix (without Xeno detection)
Sample Extracted Using a 96-well Magnetic Bead-Based Kit (high throughput method, ®includes the internal extraction control)
Refer to ASF rtPCR worksheets for automatic master mix calculations based on desired number of reactions.
African Swine Fever Real-Time PCR Assay on the Applied Biosystems QuantStudio 5 Real-Time PCR System Using the Applied Biosystems TaqMan FAST Virus 1-Step Master Mix Worksheet.docx50KB African Swine Fever real-time PCR Assay on the Applied Biosystems QuantStudio 5 Real-Time PCR System Using the Quantabio UltraPlex 1-Step ToughMix Low ROX 4X Worksheet.docx39KB Remove the selected commercial mastermix from the kit stored at -20 °C and allow to thaw within the BSC/hood. Once thawed, keep all reagents chilled.
Vortex the selected commercial mastermix reagents briefly, then centrifuge at room temperature in a microcentrifuge to bring the contents to the bottom of the tube before adding to the mastermix. Vortex the mastermix briefly.
Centrifuge the mastermix briefly in a microcentrifuge to bring the contents to the bottom of the tube. Place mastermix on ice or cold block until ready to use.
While the mastermix can be stored for up to one week in the freezer, it is ideally made fresh for each run.
| Reagent/Solution Mix | Initial Concentration | Final Concentration | Volume/RXN (µL) | ||
| Nuclease-Free Water | N/A | N/A | 11.5 | ||
| TaqMan® Fast Virus or UltraPlex 1-Step ToughMix® | 4x | 1x | 6.25 | ||
| ASF Forward Primer | 20 µM | 0.3 µM | 0.375 | 1.25 | |
| ASF Reverse Primer | 20 µM | 0.3 µM | 0.375 | ||
| ASF Probe (FAM/MGB) | 10 µM | 0.2 µM | 0.5 | ||
| Xeno™ LIZ Reagent | N/A | N/A | 1 | ||
| Total Volume | 20 | ||||
Table 3: MasterMix for the ASFV rtPCR assay using TaqMan® Fast Virus or UltraPlex® 1-Step ToughMix (with Xeno™ detection)
TaqMan® Fast Virus 1-Step Master Mix or UltraPlex® 1-Step ToughMix® Low ROX™ (4X)
Refer to ASF rtPCR worksheets for automatic master mix calculations based on desired number of reactions.
African Swine Fever real-time PCR Assay on the Applied Biosystems QuantStudio 5 Real-Time PCR System Using the Quantabio UltraPlex 1-Step ToughMix Low ROX 4X Worksheet.docx39KB African Swine Fever Real-Time PCR Assay on the Applied Biosystems QuantStudio 5 Real-Time PCR System Using the Applied Biosystems TaqMan FAST Virus 1-Step Master Mix Worksheet.docx50KB Remove the selected commercial mastermix from the kit stored at -20 °C and allow to thaw within the BSC/hood. Once thawed, keep all reagents chilled.
Vortex the selected commercial mastermix reagents briefly, then centrifuge at room temperature in a microcentrifuge to bring the contents to the bottom of the tube before adding to the mastermix. Vortex the mastermix briefly.
Centrifuge the mastermix briefly in a microcentrifuge to bring the contents to the bottom of the tube. Place mastermix on ice or cold block until ready to use.
While the mastermix can be stored for up to one week in the freezer, it is ideally made fresh for each run.
| Reagent/Solution Mix | Initial Concentration | Final Concentration | Volume/RXN (µL) | ||
| Nuclease-Free Water | N/A | N/A | 12.5 | ||
| Commercial MasterMix (TaqMan® Fast Virus or UltraPlex 1-Step ToughMix®) | 4x | 1x | 6.25 | ||
| ASF Forward Primer | 20 µM | 0.3 µM | 0.375 | 1.25 | |
| ASF Reverse Primer | 20 µM | 0.3 µM | 0.375 | ||
| ASF Probe (FAM/MGB) | 10 µM | 0.2 µM | 0.5 | ||
| Total Volume | 20 | ||||
Table 2: MasterMix for the ASFV rtPCR assay using TaqMan® Fast Virus or UltraPlex® 1-Step ToughMix (without Xeno™ detection)
| Reagent/Solution Mix | Initial Concentration | Final Concentration | Volume/RXN (µL) | ||
| Nuclease-Free Water | N/A | N/A | 11.5 | ||
| TaqMan® Fast Virus or UltraPlex 1-Step ToughMix® | 4x | 1x | 6.25 | ||
| ASF Forward Primer | 20 µM | 0.3 µM | 0.375 | 1.25 | |
| ASF Reverse Primer | 20 µM | 0.3 µM | 0.375 | ||
| ASF Probe (FAM/MGB) | 10 µM | 0.2 µM | 0.5 | ||
| Xeno™ LIZ Reagent | N/A | N/A | 1 | ||
| Total Volume | 20 | ||||
Table 3: MasterMix for the ASFV rtPCR assay using TaqMan® Fast Virus or UltraPlex® 1-Step ToughMix (with Xeno™ detection)
VetMAX™ Fast Multiplex Master Mix (with ROX)
Refer to ASF rtPCR worksheets for automatic master mix calculations based on desired number of reactions.
African Swine Fever real-time PCR Assay on the Applied Biosystems QuantStudio 5 Real-Time PCR System Using the Applied Biosystems VetMAX FAST Multiplex Master Mix with ROX Worksheet.docx40KB Remove the selected commercial mastermix from the kit stored at -20 °C and allow to thaw within the BSC/hood. Once thawed, keep all reagents chilled.
Vortex the selected commercial mastermix reagents briefly, then centrifuge at room temperature in a microcentrifuge to bring the contents to the bottom of the tube before adding to the mastermix. Vortex the mastermix briefly.
Centrifuge the mastermix briefly in a microcentrifuge to bring the contents to the bottom of the tube. Place mastermix on ice or cold block until ready to use.
While the mastermix can be stored for up to one week in the freezer, it is ideally made fresh for each run.
| Reagent/Solution Mix | Initial Concentration | Final Concentration | Volume/RXN (µL) | ||
| Nuclease-Free Water | N/A | N/A | 6.25 | ||
| VetMAX™ Fast | 2x | 1x | 12.5 | ||
| ASF Forward Primer | 20 µM | 0.3 µM | 0.375 | 1.25 | |
| ASF Reverse Primer | 20 µM | 0.3 µM | 0.375 | ||
| ASF Probe (FAM/MGB) | 10 µM | 0.2 µM | 0.5 | ||
| Total Volume | 20 | ||||
Table 4: MasterMix for the ASFV rtPCR assay using VetMAX™ Fast Multiplex Master Mix (with ROX) (without Xeno™ detection)
| Reagent/Solution Mix | Initial Concentration | Final Concentration | Volume/RXN (µL) | ||
| Nuclease-Free Water | N/A | N/A | 5.25 | ||
| VetMAX™ Fast | 2x | 1x | 12.5 | ||
| ASF Forward Primer | 20 µM | 0.3 µM | 0.375 | 1.25 | |
| ASF Reverse Primer | 20 µM | 0.3 µM | 0.375 | ||
| ASF Probe (FAM/MGB) | 10 µM | 0.2 µM | 0.5 | ||
| Xeno‱ LIZ Reagent | N/A | N/A | 1 | ||
| Total Volume | 20 | ||||
Table 5: MasterMix for the ASFV rtPCR assay using VetMAX™ Fast Multiplex Master Mix (with ROX) (with Xeno™ detection)
Setting Up the rtPCR Assay
- In the clean room, place a 96 well plate in a cold block or on ice and add 20 µL of mastermix to each well of the 96 well plate.
- Add 5 µL of nuclease-free water to the no template control (NTC) well, H11, and then loosely cover the plate to prevent cross contamination.
- Transport the mastermix in the cold block to the template addition hood and keep cold until ready to use.
- Thaw all controls and samples, if samples are frozen, vortex briefly and centrifuge in a microcentrifuge before adding each to the plate.
- Pipette 5 µL of template DNA to the designated wells.
- Pipette 5 µL of each control DNA into the designated wells (NEC in H10 and PAC in H12).
- Cover the plate with optical film or optical caps.
- Briefly centrifuge the plate to bring the sample and mastermix to the bottom of the wells.
Running the Assay
- The QuantStudio 5 can run both with and without a connected computer.
- The run can be set up on a connected computer and run directly.
- The run can also be set up on any computer with the QuantStudio™ Design & Analysis Software. Save the experiment on a thumb drive and upload it directly onto the QuantStudio™ 5 machine.
- Double-click the QuantStudio™ Design & Analysis Software icon on the Windows desktop or form the Windows "Start" menu.
- Refer to the manufacturer's user manual for instructions on how to navigate the specific software version in use on the instrument.
- General instructions, not software version specific, are provide in the subsequent sections.
Create a New Experiment
- On the "Select an Option" page, choose "Create New Experiment" or select "Template" from the drop-down option.
- "Properties", "Method", and "Plate", will appear at the top of the next screen. Click on each choice and fill out as appropriate.
Set Up the Plate Document
Plate Document Set Up on QuantStudio™ Design & Analysis Software Properties, Method, and Plate Tab
Properties Tab
Note:
Name, barcode, and username are to be filled out at the discretion of the end user or respective institutions preferences
- Instrument type: QuantStudio™ 5 System
- Block type: 96 well, 0.1 mL block
- Experiment type: Standard Curve
- Chemistry: TaqMan® Reagents
- Run Mode: Standard
Method Tab
Note: Reaction Method setup for QuantStudio™ 5 is dependent upon which mastermix type was used based on what type of sample extraction method and if Xeno was utilized or not.
Method 1: TaqMan® Fast Virus 1-Step MasterMix
- Volume of Reaction: 25 µL
- Coover Temperature: Leave as default setting
- The "Hold Stage" and "PRC Stage" should be set as shown in Table 6.
- Cycle number: 45x
*Ensure the camera icon is activated at PCR step 2 to collect fluorescent data.
| Stage | Step | Temperature °C | Time (sec) | Hold/Cycle Numbers | |
| Hold | Step 1 | 95 | 20 | HOLD | |
| PCR | Step 1 | 95 | 10 | x45 cycles | |
| Step 2* | 60 | 30 |
Table 6: Thermal Profile for ASFV rtPCR (singleplex and multiplex) with TaqMan® Fast Virus 1-Step Master Mix
Method 2: VetMAX™ Fast Multiplex (with ROX) MasterMix
- Volume of Reaction: 25 µL
- Coover Temperature: Leave as default setting
- The "Hold Stage" and "PRC Stage" should be set as shown in Table 7.
- Cycle number: 45x
*Ensure the camera icon is activated at PCR step 2 to collect fluorescent data.
| Stage | Step | Temperature °C | Time | Hold/Cycle Numbers | |
| Hold | Step 1 | 50 | 5 min | 1 | |
| Step 2 | 95 | 10 min | 1 | ||
| PCR | Step 1 | 95 | 15 sec | x45 cycles | |
| Step 2* | 60 | 1 min |
Table 7: Thermal Profile for ASFV rtPCR (singleplex and multiplex) with VetMAX™ Fast Multiplex Master Mix (with ROX)
Method 3: UlraPlex® 1-Step ToughMix® Low ROX™ MasterMix
- Volume of Reaction: 25 µL
- Coover Temperature: Leave as default setting
- The "Hold Stage" and "PRC Stage" should be set as shown in Table 8.
- Cycle number: 45x
| Stage | Step | Temperature °C | Time | Hold/Cycle Numbers | |
| Hold | Step 1 | 50 | 10 min | 1 | |
| Step 2 | 95 | 3 min | 1 | ||
| PCR | Step 1 | 95 | 10 sec | x45 cycles | |
| Step 2* | 60 | 30 sec |
Table 8: Thermal Profile for ASFV rtPCR (singleplex and multiplex) with UltraPlex® 1-Step ToughMix® with Low ROX™ (4X)
*Ensure the camera icon is activated at PCR step 2 to collect fluorescent data.
Plate Tab (The Quick Setup or Advanced Setup sub-tab can be used, based on the end user's preference)
- Targets
- For the ASFV detection portion of the assay select FAM as the reporter dye and NFQ-MGB as the quencher dye.
- For the Xeno™ detection portion of the assay select Cy5 as the reporter dye and NONE as the quencher dye.
- The "Add" button can be used to add new targets
- The "Action" drop-down button can be used to save a target to the library. You can import a target from the library or delete a target from the library.
- Confirm that the passive reference is ROX.
- Samples
- Add individual sample names for the plate setup.
- The "Add" button can be used to individually add samples.
- The "Action" drop-down button can be used to save sample IDs to the library. You can import previously saved sample IDs from the library, delete, or import sample IDs from the file.
- Assign detectors/targets and sample IDs to wells.
- Save the plate.
- Select File and then Save. Choose an appropriate directory and type the file name.
- Alternatively, the plate setup can be saved as a template. Select File and then Save as. Type the appropriate template name in the File name field.
- Choose the appropriate directory and type the file name.
- In the Save as type menu and select template (.edt).
- Start the run.
Run Analysis
Note: Software versions may differ slightly over time as modifications and updates are introduced. The information provided below shall serve as general guidelines for data analysis.
Manual Threshold Settings
- ASFV real-time TR-PCR: set the manual threshold at 0.1
- Xeno™ real-time RT-PCR: set the manual threshold at 0.1
- The baseline should be set to automatic for all targets.
- Click the Analyze button (blue button) in the top right area of the screen.
- Highlight samples for specific well results to be shown.
- To view results from a specific reporter dye, click on the icon that looks like an eye.
- From the drop-down menu next to Target choose the specific dye set to view.
Data Export
- Click on the blue "Export" tab at the top of the screen.
- On the Export Screen the file name can be modified if desired.
- The file type and content can also be set to the end user's preferences in this screen.
- Use the "Browse" button to choose the location for the exported data to be saved.
- Click the "Export" button in the upper right-hand portion of the screen.
System Shut Down
- Remove the plate from the system and discard the plate into a biohazard autoclave bag and bin.
Note: The QuantStudio 5 unit does not need to be powered down by the end user and will enter a "sleep mode" without end user activity. However, to maintain machine health, component use, or bulbs a complete shutdown may be beneficial and it up to the end user and institution.
Interpretation of the Assay
Interpretation of Assay Positive, Negative, and Inclusive Results
Sample Result Definitions
Note(s):
- A positive real-time PCR curve must have a sigmoidal nature on the graph where the X-axis represents the PCR cycle number, and the Y-axis represents the relative fluorescence.
- The threshold should be set for 0.1 for ASFV and Xeno™ real-time RT-PCR assays.
- Positive ASFV Result: The sigmoidal curve crosses the ASFV threshold with a Ct value less than 40 (Ct < 40).
- Inconclusive ASFV Result: The amplification curve rises above the threshold line between cycles 40 and 45 (40 ≤ Ct ≤ 45).
- Negative ASFV Result: The curve does not cross the threshold line prior to cycle 45 (Undetermined).
Result Validity and Internal Control (Xeno™) Logic
Note: Based upon studies at FADDL, Xeno™ Ct values are expected to be in the low to mid 30's. However, at times the Ct value could be higher depending on the level of inhibition in the sample.
- To determine if the result is valid use the following logic:
| Target (ASFV) Ct Value | Xeno™ | Final Result and/or Action Needed | |
| Ct < 40 | Ct < 40 | Valid (Target Positive) | |
| 40 ≤ Ct ≤ 45 | |||
| Undetermined | |||
| 40 ≤ Ct ≤ 45 | Ct < 40 | Valid (Target Inconclusive) | |
| 40 ≤ Ct ≤ 45 | Consult Supervisor/SME (Possible inhibition maybe present in the sample. Check controls and consult with your supervisor for retesting options.) | ||
| Undetermined | Not Valid (Controls should be checked to determine retest) | ||
| Undetermined | Ct < 40 | Valid (Target Negative) | |
| 40 ≤ Ct ≤ 45 | Not Valid (Check controls to determine retest) | ||
| Undetermined |
Table 9: ASFV real-time PCR Assay Results Interpretation. Determination table for sample validity and final results based on the relationship between the Target (ASFV) Ct value and the Xeno™ internal control Ct value. Interpretation is based on a set threshold of 0.1 for both targets, with results classified as Valid (Positive, Negative, or Inconclusive), Not Valid (requiring retest), or requiring further consultation due to potential sample inhibition.
Control Requirements and Corrective Actions
Note: The expected results of the control(s) may/will vary from lot to lot and so it is important to have QA/QC of probes and primers and to check things against the reference panels, currently accepted ranges provided to the laboratory, or according to the respective institutions guidelines.
- Positive Extraction Control: If out of range, inconclusive, or not positive the entire extraction and PCR must be repeated.
- Positive Amplification Control: It out of range, inconclusive, or not positive, the real-time PCR must be repeated.
- Negative Extraction Control: If not negative for the ASFV target, the entire extraction and real-time PCR must be repeated.
- Negative Amplification Control: If not negative for the ASFV target or the Xeno™ target, the real-time PCR must be repeated.
Assay Interpretation Schematic
Image 1: ASFV rtPCR Assay Results Interpretation Schematic for Positive, Negative, and Inconclusive Results
Protocol references
Zsak, L., Borca, M. V., Risatti, G. R., Zsak, A., French, R. A., Lu, Z., Kutish, G. F., Neilan, J. G., Callahan, J. D., Nelson, W. M., & Rock, D. L. (2005). Preclinical diagnosis of African swine fever in contact-exposed swine by a real-time PCR assay. Journal of Clinical Microbiology, 43(1), 112–119. https://doi.org/10.1128/jcm.43.1.112-119.2005
Note(s): Two modifications were made to the primers from the original publication.
1. Original Publication Forward Primer Sequence: 5′-C(C)TCGGCGAGCGCTTTATCAC-3′
2. Modification for this protocol Forward Primer: 5'-C(T)TCGGCGAGCGCTTTATCAC-3'
3. Original Publication Reverse Primer Sequence: 5′-GGAAA(C)TCATTCACCAAATCCTT-3′
4. Modification for this protocol Reverse Primer: 5'-GGAAA(T)TCATTCACCAAATCCTT-3'
Lucas, J., Holder, D., Dodd, K., & Wei, J. (2020). A versatile dual-use RT-PCR control for use in assays for the detection of peste des petits ruminants virus. Journal of Virological Methods, 277, 113799.
Thermo Fisher Scientific. QuantStudio‱ 5 Real Time PCR System Installation, Use, and Maintenance Guide (Pub. No. MAN0028412).
Thermo Fisher Scientific. TaqMan‱ Fast Virus 1 Step Master Mix User Guide (Pub. No. MAN0028278).
Thermo Fisher Scientific. TaqMan‱ Fast Virus 1 Step Multiplex Master Mix (No ROX) User Guide (Pub. No. MAN0026486).
Thermo Fisher Scientific. VetMAX‱ Xeno‱ Internal Positive Control Assay User Guide (Pub. No. MAN0014500).
Thermo Fisher Scientific. VetMAX‱ Fast Multiplex Master Mix (with ROX) Product Information (Pub. No. MAN0028688).
Thermo Fisher Scientific. MagMAX‱ Pathogen RNA/DNA Kit User Guide (Pub. No. MAN0030202).
Thermo Fisher Scientific. MagMAX‱ CORE Nucleic Acid Purification Kit User Guide (Pub. No. MAN0015944).
Quantabio. UltraPlex‱ 1 Step ToughMix‱ Low ROX (4X) Instructions for Use.
Qiagen. DNeasy‱ Blood and Tissue Kit Handbook.
INDICAL BIOSCIENCE. IndiMag Pathogen Kit User Guide.
OIE (World Organization for Animal Health). Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: African Swine Fever.