Preparation of Positive Controls and Inhibition Assay for the Six-plex Digital PCR Assay targeting SARS-CoV-2 N1, SARS-CoV-2 N2, MHV, Influenza A Virus, Influenza B Virus, and Respiratory Syncytial Virus
Protocol Citation: Melissa Pitton, Rachel E. McLeod, Lea Caduff, Ayazhan Dauletova, Jolinda de Korne-Elenbaas, Charles Gan, Camille Hablützel, Aurélie Holschneider, Seju Kang, Guy Loustalot, Patrick Schmidhalter, Linda Schneider, Anna Wettlauffer, Daniela Yordanova, Timothy R. Julian, Christoph Ort 2026. Preparation of Positive Controls and Inhibition Assay for the Six-plex Digital PCR Assay targeting SARS-CoV-2 N1, SARS-CoV-2 N2, MHV, Influenza A Virus, Influenza B Virus, and Respiratory Syncytial Virus. protocols.io https://dx.doi.org/10.17504/protocols.io.14egn1jeyv5d/v1
Manuscript citation:
Pitton, M., McLeod, R.E., Caduff, L. et al. A six-plex digital PCR assay for monitoring respiratory viruses in wastewater. Nat Water3, 1174–1186 (2025). https://doi.org/10.1038/s44221-025-00503-x
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 16, 2026
Last Modified: March 16, 2026
Protocol Integer ID: 243375
Keywords: plex digital pcr assay, respiratory syncytial virus this protocol, targeting sar, respiratory syncytial virus, containing sar, controls for the inhibition assay, amount of target sar, inhibition assay, target sar, sar, resp6, preparation of positive control
Funders Acknowledgements:
Swiss National Science Foundation
Grant ID: CRSII5_205933
Swiss Federal Office of Public Health
Grant ID: 142006108/334.0-101/26
Abstract
This protocol describes the preparation of positive controls for the Six-plex digital PCR assay targeting SARS-CoV-2 N1, SARS-CoV-2 N2, MHV, Influenza A Virus, Influenza B Virus, and Respiratory Syncytial Virus, heretofore referred to as the "RESP6" Assay. Additionally, it describes the preparation of spike-in controls for the inhibition assay, containing SARS-CoV-2. Inhibition is measured in this protocol by adding and measuring an expected amount of target SARS-CoV-2 RNA to the samples, and comparing the measured concentration in the spiked sample to the expected spike-in concentration plus the measured sample concentration.
Materials
Consumable
Positive control stock material (Table 1), stored at -80°C
Nuclease-free water (Promega: cat. no. P1195)
5 mL Eppendorf tubes with snap cap, PCR clean, (Huberlab, cat. no. 11.3819.46)
GTATTAACATTATCAAGCTTGACATCAGAAATACAAGTCAATATTGAGATAGAATCTAGAAAGT
CCTACAAAAAAATGCTAAAAGAGATGGGAGAAGTGGCTCCAGAATATAGGCATGATTCTCCAGA
CTGTGGGATGATAATACTGTGTATAGCTGCCCTTGTAATAACCAAATTAGCAGCAGGAGATAGA
TCAGGTCTTACAGCAGTAATTAGGAGGGCAAACAATGTCTTAAAAAACGAAATAAAACGCTACA
AGGGCCTAATACCAAAAGACATAGCCAACAGTTTTTATGAAGTATTTGAAAAATACCCTCATCT
T
Table 2 RESP6 positive control gBlock sequences
Equipment
Pipettes 1000 μL, 200 μL, 20 μL, 10 μL
Multistep pipette, 200 μL
Vortex Genie 2
LLG-uniCFUGE 2 Mini Centrifuge
Grant bio UVC/T-M-AR PCR cabinet, “template box”
Laboratory freezer (-20°C)
Laboratory freezer (-80°C)
Laptop or computer with internet access
Analytical material
Positive control stocks should be stored at -80°C. Stock dilutions are stored at the same temperatures. Mixed controls (working solutions) containing gBlocks, synthetic full genomes and virus extracts are kept at -20°C for easier access.
Troubleshooting
Safety warnings
After preparation, the waste bin can be emptied into an autoclave bag and disposed of in accordance with institutional policies.
Scope
This protocol specifically details the preparation of positive controls for the RESP6 assay and spike-in for the assay to determine PCR inhibition. The RESP6 assay targets SARS-CoV-2 N1 and N2 genes, IAV M-gene, IBV M-gene, RSV N-gene, and MHV and is run on the Stilla Naica‱ system using Crystal Digital PCR‱. Per geode, a positive control is always run alongside samples to control assay performance and to provide the basis for gating. For determination of PCR inhibition, spike-in controls are added to the RESP6 Mastermix. This protocol includes information on stock and working solutions used to prepare the controls, as well as on how to prepare the mixture of targets.
The goal of this procedure is to prepare positive controls for the RESP6 and inhibition assays that contain all material needed to assess assay performance.
Stock and dilution series quantification
Based on the manufacturers provided concentration range, make a 10-fold dilution series that theoretically falls within the detectable range of the dPCR machine (ideally ~5000-50 genome copies/µL sample).
Quantify three 10-fold dilutions within the theoretical dynamic linear range (i.e., Sapphire chips: 0.2-20’000 cp/uL), according to the associated RESP6 assay protocol.
Stocks and dilutions are stored at -80°C. Avoid freeze/thaw cycles, for example by preparing in advance multiple aliquots of desired dilutions and using aliquots only once.
RESP6 positive control calculation
The desired target concentration should be approximately 100 gc/uL reaction (raw Stilla output).
If a dilution goes through a freeze/thaw cycle, we have observed an approximate loss of 20% of our targets due to freeze/thaw cycles. To accommodate this, we estimate the expected measurement by inputting 80% of the previous measured cp/uL from the last measurement into the sheet as a general guidance. Recommendation: The amount of loss of target due to freeze/thaw may vary by laboratory, buffer, or other storage and handling conditions.
RESP6 positive control preparation
Prepare an empty Eppendorf tube (depending on the total volume) for the mixture and 0.2 mL tubes according to the number of aliquots you would like to create for the positive control aliquots under UV light for 20 minutes.
Take all individual positive control dilutions out of the freezers, thaw at room temperate, vortex well and spin down.
Prepare the positive control by mixing the calculated amounts of each target and water in an Eppendorf tube according to your calculated volumes.
Vortex the mixture very well and spin down using a table centrifuge.
Divide the mixture into aliquots according to the volume per aliquot you decided on.
Store aliquots at -20C freezer.
INHIBITION control calculation
Calculate how much the SARS-CoV-2 positive control should be diluted for inhibition testing as follows:
For SARS-N1 volume calculation:
“Desired total mix volume (uL) / “Measured concentration in gc/uL reaction” / “Needed target concentration in gc/uL reaction”
To calculate amount of water to add:
“Desired total mix volume (uL)” – “Volume of target solution to pipet”
Note: If the amount of water is negative, the concentrated stock solution concentration is too low, and a a higher concentrated stock solution needs to be created.
The recommended target concentration is 15 gc/uL reaction (raw Stilla output) for inhibition spike.
INHIBITION control preparation
Prepare an Eppendorf tube for the mixture and 0.2mL tubes for the inhibition control spike aliquots and UV light for 20 minutes.
Take the SARS-N1 positive control dilution out of the freezer, let it thaw at room temperate, vortex well and spin down on a tabletop centrifuge.
Prepare the inhibition control by mixing the appropriate amount of stock solution and water together in the Eppendorf tube.
Vortex the mixture very well and spin down.
Divide the mixture into aliquots.
For every new batch, perform a test run according to the inhibition assay protocol. For inhibition, because SARS-N2 is added to the mastermix, the no-template-controls will contain SARS-N2 target at the background concentration used to measure inhibition. For this reason, run 4 replicates of the inhibition mastermix with SARS-N2 and additional water as template to determine SARS-N2 concentration in the mastermix. Adjust your spike-in volume for the inhibition assay protocol according to your measurement.
Quality control
Every newly prepared batch of controls should be tested before use. For the RESP6 positive controls, 2 replicates of the newly prepared batch and 2 replicates of NTCs are run with the RESP6 assay. A batch is approved for usage if all six targets are detected in the positive controls and concentrations ranging between 30-300 gc/uL reaction (raw Stilla output).
Protocol references
Pitton, M., McLeod, R.E., Caduff, L. et al. A six-plex digital PCR assay for monitoring respiratory viruses in wastewater. Nat Water3, 1174–1186 (2025). https://doi.org/10.1038/s44221-025-00503-x
This study was funded by the Swiss National Science Foundation (SNSF Sinergia grant number CRSII5_205933)
and by the Swiss Federal Office of Public Health (grant numbers 142006108/334.0-101/26 and 142006655/334.0-107/12) granted to C.O. and T.R.J.
Protocol Prepared for Protocols.io by: Darine D'Adam, Eawag, Swiss Federal Institute of Aquatic Science and Technology