Jul 16, 2023

Preparation of parts HygR-LHRZ and ZeoR-LHRZ

  • 1University of Edinburgh
Icon indicating open access to content
QR code linking to this content
Protocol CitationDariusz Abramczyk 2023. Preparation of parts HygR-LHRZ and ZeoR-LHRZ. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l271o3g1y/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol. This is a protocol for preparation of a double-feature part (antibiotic selection marker- LHRZ)
Created: March 09, 2023
Last Modified: July 16, 2023
Protocol  Integer ID: 78443
Keywords: lhrz this cloning protocol, preparation tandem pair hygr, insertion array before pichia transformation, combinatory assembly system for preparation, lhrz tandem pair, combinatory assembly system, homology recombination region, recombination process, cloning protocol, antibiotic selection marker, insertion array, pichia transformation, swapping hr, lhrz, hr event while the lhrz, preparation of parts hygr
Abstract
This cloning protocol is for preparation tandem pair HygR-LHRZ and ZeoR-LHRZ as a part of combinatory assembly system for preparation of integration/insertion arrays.

Either the HygR-LHRZ or the ZeoR-LHRZ tandem pairs are designed to be use for all arrays and are displayed on 3'-end each of arrays.
During inchworming/swapping HR double cross-over recombination process, the antibiotic selection marker is replaced in every HR event while the LHRZ works as a homology recombination region used during all inchworming/swapping rounds.




Both parts are AsiSI free (this is for an optional excise site the cassette from the plasmid to isolate an insertion array before Pichia transformation)

General scheme for preparation library of AntR-LHRZ


Protocol materials
BamHI-HF - 50,000 unitsNew England BiolabsCatalog #R3136L
KpnI-HF - 20,000 unitsNew England BiolabsCatalog #R3142L
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
Carbenicillin
Carbenicillin, disodium saltBio Basic Inc.Catalog #CDJ469.SIZE.1g
PrimeSTAR GXL PremixCatalog #R051B
BamHI-HF - 10,000 unitsNew England BiolabsCatalog #R3136S
SalI-HF - 2,000 unitsNew England BiolabsCatalog #R3138S
Gibson Assembly Cloning Kit - 10 rxnsNew England BiolabsCatalog #E5510S
AsiSI - 2,500 unitsNew England BiolabsCatalog #R0630L
1 g Carbenoxolone DisodiumbiorbytCatalog #orb320280
Cloning and preparation of HygR-LHRZ and ZeoR-LHRZ, integrative/insertion array lasting 3'-part
4h
Preparation of LHRZ - the first part of sequential cloning into pUC19

PCR preparation part LHRZ for cloning with KpnI/BamHI (3'-end of LHRZ with
BsaI or BsmBI RE site delivered by an oligo)
02:00:00

PrimeSTAR GXL PremixCatalog #R051B
Aexpected size 998bpexpected size 998bp
components LHRZ for (BsmBI)LHRZ for (BsaI)
eDA8 (125pg/uL)11
oligo 3101.251.25
oligo3171.25
oligo 3181.25
PrimeStar Premix 2x25
waterup to 50
LHR(non-coding DNA) delivered from the DNA library design by dr Valentin Zulkover and synthesised by prof Adele Marston Adele Marston lab
ABC
310 (F)LHRZ (BamHICCGGATCCCCGTGTAGGTCTACAAACTGG
318 (R)LHRZ (KpnI-BsmBI-AsiSI)GCGGTACCCGTCTCAcgcgGCGATCGCCCTGCAGGTTGAGTTGGCGAAGGTGCG
317 (R)LHRZ (KpnI-BsaI-AsiSI)GGGGTACCGGTCTCAcgcgGCGATCGCCCTGCAGGTTGAGTTGGCGAAGGTGCG
Programtimenumber of cycles
98oC10 sec33 x
55oC10sec
68oC1min 30 sec
4oChold

2h
00:30:00
PCR clean-up QIAquick PCR Purification Kit (Qiagen)QIAquick PCR Purification Kit
Elution with water 50uL
30m

KpnI and BamHI digestion of PCR product and pUC19 (all enzymes NEB) BamHI/ KpnI
KpnI-HF - 20,000 unitsNew England BiolabsCatalog #R3142L
BamHI-HF - 50,000 unitsNew England BiolabsCatalog #R3136L

ABCD
10 x CutSmart888
BamHI-HF (20u/uL)1.51.51
KpnI-HF (20u/uL)1.51.51
PCR LHRZ 310/31750
PCR LHRZ 310/31850
pUC19 298 ng/uL10
waterup to 80 ->
RE digestion reactions
37 °C 04:00:00
4h
00:30:00
PCR clean-up QIAquick PCR Purification Kit (Qiagen)QIAquick PCR Purification Kit
Elution with water 50uL
Checking DNA concentration
LHRZ 310/317 (BamHI/KpnI) - ~100ng/ul
LHRZ 310/318 (BamHI/KpnI) - ~100ng/ul
30m
Ligation reactions T4 DNA ligase (NEB)
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
A12
pUC B/K ~100ng/uL) BamHI/KpnI11
T4 DNA ligase11
LHRZ (100ng/ul) B/K(310/317)5.5
10 X buffer11
waterup to 10 ->
LHRZ (100ng/ul)(310/318) B/K5.5
Overnight 16oC


02:00:00

E.coli transformation (DH5alpha chemically LiAc competent cells)E.coli chemical competent cells
Selection on LB +100ug/mL Carbenicillin and growth at Overnight 37 °C
2h

01:00:00
Several colonies obtained on both agar plates. Single colonies transferred on new LB +100ug/mL ampicillin plate, growth overnight and a single colonies submitted for bacterial colony PCR.
see protocol colony PCR
Material loaded on agarose gel for verification
E.coli colony PCR
Positively verified clones re-cultured in LB + 100 ug/mlCarbenicillin, disodium saltBio Basic Inc.Catalog #CDJ469.SIZE.1g for miniprep (plasmid preparation)Overnight
1h
Plasmid isolation (miniprep) Qiagen miniprep 01:00:00
PCR verified and Sanger sequencing intermediate plasmid LHRZ(BsmBI)-pUC19 called eDA101Download eda101.dnaeda101.dna
PCR verified and Sanger sequencing intermediate plasmid LHRZ(BsaI)-pUC19 called eDA99Download eDA99.dnaeDA99.dna

1h
Preparation of ZeoR-LHRZ and HygR-LHRZ
The final step - insertion of ZeoR or HygR into plasmid eDA101 and eDA99 correspondingly
PCR amplification of Zeocin expression cassette (BsaI-free) for cloning with BsmBI
Zeocin and hygromycin cassettes originally derived from plasmids pGS-GnTI and pGS-GnTII (Glycoswitch) glycoswitch plasmids
PrimeSTAR GXL PremixCatalog #R051B
componentsZeoRHygR
eDA48 (175 (ng/uL)1
eDA78 (125pg/uL)1
oligo 3081.25
oligo3091.25
oligo 3061.25
oligo 3071.25
PrimeStar Premix 2x2525
waterup to 50up to 50uL
ABC
308 (F)Zeocin cassette (SalI-BsmBI) overhang GTAGCTGTCGACCGTCTCAgtagCCCACACACCATAGCTTCAAAATG
309(R)Zeocin cassette (BamHI)GGGATCCGCAAATTAAAGCCTTCGAGCG
306 (F)HygR (SalI-BsaI)CCTGTCGACGGTCTCAgtagGACATGGAGGCCCAGAATACCC
307 (R)HygR (BamHI)GCGGATCCCAGTATAGCGACCAGCATTCACATAC

00:30:00
PCR clean-up QIAquick PCR Purification Kit (Qiagen)QIAquick PCR Purification Kit
Elution with water 50uL
30m
SalI and BamHI digestion of PCR product and pUC19 (all enzymes NEB)BamHI
BamHI-HF - 10,000 unitsNew England BiolabsCatalog #R3136S
SalI-HF - 2,000 unitsNew England BiolabsCatalog #R3138S
componentsBCDE
10x cutsmart buffer NEB8888
BamHI-HF (20u/uL)1.51.51.51.5
eDA99 70 ng/uL30
eDA101 81 ng/uL30
PCR hygR 306/30750
PCR zeo 308/30950
SalI-HF (20u/uL)1.51.51.51.5
waterup to 80 ->
37 °C 04:00:00
4h
00:30:00
PCR clean-up QIAquick PCR Purification Kit (Qiagen)QIAquick PCR Purification Kit
Elution with water 50uL
loaded 2 ul of each fraction
30m
Ligation reactions T4 DNA ligase (NEB)

T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
T4 DNA ligase11
10 X buffer11
eDA101 (S/B)3
zeo 308/309 (S/B)5
eDA99 (S/B)3
hygR 306/307 (S/B)5
waterup to 10 ->
Overnight 16oC


02:00:00

E.coli transformation (DH5alpha chemically LiAc competent cells)E.coli chemical competent cells
Selection on LB + 100ug/mL carbenicillin and growth at Overnight 37 °C
Carbenicillin, disodium saltBio Basic Inc.Catalog #CDJ469.SIZE.1g

2h
01:00:00
.Several colonies obtained on both agar plates. Single colonies transferred on new LB +100ug/mL ampicillin plate, growth overnight and a single colonies submitted for bacterial colony PCR
see protocol colony PCR
(oligo 131/40 for verification ZeoR-LHRC-puC see plasmid map Download eda105.dnaeda105.dna
(oligo 306/42 for verification HygR-LHRC-puC see plasmid map Download eda103.dnaeda103.dna
Material loaded on agarose gel for verification
All colonies verified positively
Positively verified clones re-cultured in LB ampicillin for miniprep (plasmid preparation)Overnight
1h
Plasmid isolation (miniprep) Qiagen miniprep 01:00:00
PCR verified and Sanger sequencing intermediate plasmid ZeoR-LHRC-puC see plasmid Download eda105.dnaeda105.dna
Tandem paired ZeoR-LHRZ part (BsmBI-free, AsiSI-free,) ready for cloning with BsmBI as a PCR template for a use in the protocol

PCR verified and Sanger sequencing intermediate plasmid HygR-LHRC-puC see plasmid map Download eda103.dnaeda103.dna The part is BsaI-free but contains internal AsiSI in hph gene , requires mutagenesis

1h
Mutagenesis of AsiSI in eDA103 plasmid by Gibson assembly
Schematics of mutagenesis of AsiSI site in HygR by Gibson assembly.
Note
eDA103 contains two AsiSI sites, but only AsiSI site in HygR needs to be removed as a part of integration/insertion array. Another AsiSi site (in pUC19 vector) is not taking under a consideration.

01:30:00 PCR amplification for further Gibson assembly reaction
PrimeSTAR GXL PremixCatalog #R051B
PrimeStarHS 2x premix (Takara) High Fidelity
components for Gibson 1for Gibson 2
waterup to 50 uLfor Gibson 1
Primestar2x2525
oligos 327/3201.25/1.25
oligos 319/3261.25/1.25
eDA103 (74pg/uL)1.51.5
PROGRAM TAK-2.30time reactioncycles
98C10sec33x
55C10 sec
68C2min 30 sec
4Chold
PCR reaction treatment with DpnI for 00:30:00 at 37 °C

2h
00:30:00 PCR clean-up QIAquick PCR Purification Kit (Qiagen)QIAquick PCR Purification Kit
Elution with water 50uL.
DNA Molar concentration of purified PCR products was calculated using bioline conventor DNA concentration convertor
Gibson 1 fragment 86 ng/uL
Gibson 2 fragment 46 ng/ul

PCR products verified on 1% agarose gel (4 uL loaded)

30m
Gibson assembly of 3.3kb fragment 1 and 1.9kb fragment 2
Gibson Assembly Cloning Kit - 10 rxnsNew England BiolabsCatalog #E5510S
00:30:00 37 °C
AB
Gibson1 319/326 (3.3kb) 40nM 3.3 kb1
Gibson2 327/320 (2.05 kb) 40nM1
Gibson 2x mix2.5
water0.5
Gibson assembly protocol protocol NEB Gibson Assembly Master Mix
Immediately after Gibson reaction is E.coli transformation (DH5alpha chemically LiAc competent cells)E.coli chemical competent cells
Selection on LB +100ug/mL ampicillin and growth at Overnight 37 °C


30m
Single colonies verified by colony PCR
01:00:00
Several colonies obtained on both agar plates. Single colonies transferred on new LB +100ug/mL ampicillin plate, growth overnight and a single colonies submitted for bacterial colony PCR
see protocol colony PCR
Oligos 41 and 307 used for primary verification.
Oligo sequences available in the plasmid eDA115 map Download eda115.dnaeda115.dna


1h
Positively verified clones re-cultured in LB + 100 ug/m 1 g Carbenoxolone DisodiumbiorbytCatalog #orb320280 for miniprep (plasmid preparation)Overnight

Plasmid isolation (miniprep) Qiagen miniprep 01:00:00
1h
Restriction digestion verification. Plasmid eDA115 Download eda115.dnaeda115.dna digested with AsiSI (NEB)
AsiSI - 2,500 unitsNew England BiolabsCatalog #R0630L
ABC
AsiSI 11
eDA115 326 ng/uL3
eDA103 103 ng/uL8
10 x CutSmart33
waterup to 30 ->

Tandem paired Hyg-LHRZ part (BsaI-free, AsiSI-free,) ready for cloning with BsaI as a PCR template for a use in the protocol