Jun 13, 2025
Perturb-seq Using ABE8e Base Editing to Functionally Characterize a Subset of Blood Pressure- and CAD-Associated Genetic Variants in TeloHAEC Cells
- Jennifer Zevounou1,2,
- Hicham Belhaj1,
- Chao-Sheng Lo1,
- Estelle Lecluze1,
- Ken Sin Lo1,
- Guillaume Lettre1,2
- 1Montreal Heart Institute;
- 2Université de Montréal
Protocol Citation: Jennifer Zevounou, Hicham Belhaj, Chao-Sheng Lo, Estelle Lecluze, Ken Sin Lo, Guillaume Lettre 2025. Perturb-seq Using ABE8e Base Editing to Functionally Characterize a Subset of Blood Pressure- and CAD-Associated Genetic Variants in TeloHAEC Cells. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpqpbdlzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 04, 2025
Last Modified: June 13, 2025
Protocol Integer ID: 219561
Keywords: TeloHAEC, Blood Pressure (BP), Coronary Artery Disease (CAD), Genome-wide association studies (GWAS), Adenine Base Editing (ABE) Screening, scRNA-seq, Pertub-seq, transcriptomic consequences of specific genetic edit, specific genetic edit, pooled adenine base editing, associated genetic variants in telohaec cell, associated genetic variant, genetic variant, adenine base editing, using abe8e base editing, abe8e base editing, transcriptomic consequence, genome, crispr perturbation, human endothelial cell, endothelial cell, coronary artery disease, throughput functional annotation of disease, cell rna, uk biobank data, gwa, blood pressure, sequencing, using uk biobank data
Funders Acknowledgements:
Guillaume Lettre
Grant ID: HG012010
Abstract
This study follows a previously developed pooled Adenine Base Editing (ABE) screen that assessed the functional impact of 1,271 genetic variants associated with blood pressure (BP) traits and coronary artery disease (CAD) in human endothelial cells (TeloHAEC). That screen, based on variants identified through genome-wide association studies (GWAS) and fine-mapped using UK Biobank data, enabled high-throughput functional annotation of disease-linked loci.
Building upon this, the current protocol describes a Perturb-seq approach to characterize a selected subset of these variants at single-cell resolution. This method combines ABE8e-mediated base editing with single-cell RNA sequencing of CRISPR perturbations to elucidate the transcriptomic consequences of specific genetic edits in endothelial cells.
Materials
| A | B | C | |
| Name | SKU | VendorName | |
| polybrene (hexadimethrine bromide) | H9268-5G | Merck MilliporeSigma (Sigma-Aldrich) | |
| Tissue culture plate 6 wells Falcon | CA62406-161 | VWR International (Avantor) | |
| Falcon tube 50 ml | 1443222 | Thermo Fisher Scientific | |
| Millipore Steriflip sterile disposable 0.45uM | SE1M003M00 | Thermo Fisher Scientific | |
| pMD2.G | 12259 | addgene | |
| Plus reagent | 11514015 | Life Technologies | |
| Lipofectamine 2000 | 11668-019 | Life Technologies | |
| BSA Stock Solution | 130-091-376 | Miltenyi Biotec | |
| Falcon tube 15ml | 1495949B | Thermo Fisher Scientific | |
| Opti-MEM | 31985070 | Life Technologies | |
| psPAX2 | 12260 | addgene | |
| Falcon T-175 | 83.3912.002 | Sarstedt | |
| DMEM High glucose with glutamax and Sodium pyruvate | 10569010 | Life Technologies | |
| FBS premium grade 500ml for 293FT | 97068-085 | VWR International (Avantor) | |
| TRYPLE express | CC-5002 | Cedarlane | |
| Vascular Cell Basal Medium | PSC-100-030 | Cedarlane | |
| Vascular Endothelial cell growth kit-VEGF | PSC-100-041 | Cedarlane | |
| Puromycin dihydrochloride | P9620-10ML | Merck MilliporeSigma (Sigma-Aldrich) | |
| pen/strep 100X, 100mL | 450-201-EL | Wisent Bioproducts | |
| T75 TC FLASK CN VENT CAP/CS100 | 83.3911.002 | Sarstedt | |
| HEPES buffered saline solution | CC-5024 | Cedarlane | |
| Trypsin-EDTA for Primary cells | PSC-999-003 | Cedarlane | |
| Trypsin neutralizing solution | PSC-999-004 | Cedarlane |
Protocol materials
polybrene (hexadimethrine bromide)Merck MilliporeSigma (Sigma-Aldrich)Catalog #H9268-5G
Tissue culture plate 6 wells FalconVWR International (Avantor)Catalog #CA62406-161
Falcon tube 50 mlThermo Fisher ScientificCatalog #1443222
Millipore Steriflip sterile disposable 0.45uMThermo Fisher ScientificCatalog #SE1M003M00
pMD2.GaddgeneCatalog #12259
Plus reagentLife TechnologiesCatalog #11514015
Lipofectamine 2000Life TechnologiesCatalog #11668-019
BSA Stock SolutionMiltenyi BiotecCatalog #130-091-376
Falcon tube 15mlThermo Fisher ScientificCatalog #1495949B
Opti-MEMLife TechnologiesCatalog #31985070
psPAX2addgeneCatalog #12260
Falcon T-175SarstedtCatalog #83.3912.002
DMEM High glucose with glutamax and Sodium pyruvateLife TechnologiesCatalog #10569010
FBS premium grade 500ml for 293FTVWR International (Avantor)Catalog #97068-085
TRYPLE expressCedarlaneCatalog #CC-5002
Vascular Cell Basal MediumCedarlaneCatalog #PSC-100-030
Vascular Endothelial cell growth kit-VEGFCedarlaneCatalog #PSC-100-041
Puromycin dihydrochloride Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9620-10ML
pen/strep 100X, 100mLWisent BioproductsCatalog #450-201-EL
T75 TC FLASK CN VENT CAP/CS100SarstedtCatalog #83.3911.002
HEPES buffered saline solutionCedarlaneCatalog #CC-5024
Trypsin-EDTA for Primary cellsCedarlaneCatalog #PSC-999-003
Trypsin neutralizing solutionCedarlaneCatalog #PSC-999-004
Troubleshooting
Variant selection
Input variants
All 1281 variants analysed in the previous Base Editing Screen (dx.doi.org/10.17504/protocols.io.5qpvo9ybxv4o/v1)
Variants annotation
All variants were annotated for their presence in:
- a coding sequence of gene of interest for endothelial cells (top expressed genes in endothelial cell (Dai et al,PMID: 35610053) , differentially expressed gene in teloHAEC +/- TNFa, differentially expressed gene in HAECs depending flow exposure (Wu et al, PMID: 28556776)
- an endothelial cell or teloHAEC active +enhancer, characterized with the ENCODE rE2G and scE2G model
Variants were also annotated with their:
- finemapping results for Systolic Blood Pressure and Diastolic Blood Pressure (Keaton et al, PMID: 38689001)
- base editing results from the previous base editing Screen
Variants selection
Firstly, all variants were filtered based on their BEAN results from the previous Base Editing Screen: variants with an editing rate >= 10% and an effect size, abs(mu_z_adj) > 5, were considered.
Then, variants were filtered based on their relative genes. A few loci were eliminated:
- AIDA : the causal variant that we proposed in Lalonde et al is not tested (it is not an A-target variant)
- ALDH2 : the gene maps to the SH2B3/ATXN2 locus. SH2B3 is very pleiotropic and has a validated role in immune cells.
- CALCRL: the gene is expressed at low levels in teloHAEC. And the putative causal variant (rs880890, PMID: 38602103) is tested and not significant.
- FHL3: expressed at low levels in teloHAEC
- MAT2A: In our PLoS Genet paper, we identified 3 promising variants at this locus. 1 is not screened and the 2 others are not A-to-G variants. Following up on these 5 variants would be difficult to reconcile with our previous results.
At the end, 31 variants present in 6 loci (CDKN1A,ERG,PLPP3,PECAM1,TGFB1,SMAD3) were selected.
Guide RNA (gRNA) design
The teloHAEC genome sequence was used to design the gRNA library, with genetic variation in the editing window accounted for when appropriate. Alleles at non-A (or T) variants cannot be installed using the ABE
editing strategy. However, because other A’s may be present in the editing windows and bystander edits could provide useful information, all selected variants were targeted by the gRNA library, independent of the variant genotype in teloHAEC. With bedtools and the teloHAEC genome sequence, the genomic sequence around the targeted variants was retrieved, and five 20-bp gRNAs were designed for each variant, shifting the variant targeted for editing from position #4 in the editing window (gRNA1) to position #5 (gRNA2), #6 (gRNA3), #7 (gRNA4), and #8 (gRNA5). After this initial design, the gRNA sequences were re-aligned to the teloHAEC genome to account for other nearby genetic variants (i.e., variants not associated with BP or CAD but residing near the targeted variants). When appropriate, these variants were introduced into the gRNA sequences to minimize mismatches.
The strategy developed by Ryu et al. (PMID: 38658794) was adopted, adding a reporter sequence for each gRNA. This reporter includes the same 20 nucleotides as the gRNA and is used to measure editing efficiency. In total, 104 gRNAs were designed to target 31 variants.
Pertub-seq library cloning
The pooled gRNA library was synthesized by Agilent Technologies.
Guide library structure for ABE screen:
5'-ggaaaggacgaaacaccg[2-nt gRNA]GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCT
AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT[32-nt target (6-nt upstream, 20-nt gRNA, 6-nt PAM)][7-nt barcode] AGATCGGAAGAGCACACGNNNNNNNNNNNNNN-3'
Reconstitute ssDNA oligo pool:
1- Spin down lyophilized ssDNA oligo pool.
2- Prepare 20 ng/µL stock by resuspending in TE buffer with low EDTA (10mM Tris-Cl pH 8.0, 0.1 mM EDTA).
Insert preparation
1- Perform a first PCR:
Primers for PCR1 :
| A | B | |
| Sequence | ||
| BE_Sensor_Fwd | TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG | |
| BE_Sensor_PCR1_1_Rev | TCACCTTGCTACGTCGTGT |
PCR1 Reaction:
| A | B | |
| Volume (ul) | ||
| Oligo pool (20ng/ul) | 1 | |
| NEBNext Ultra II Q5 Master Mix (E7805L) | 10 | |
| PCR1 forward primer (10uM) | 1 | |
| PCR1 reverse primer (10uM) | 1 | |
| dd H2O | 7.5 | |
| Total volume | 20 |
Cycling:
| Temp | Time | Cycles | ||
| Step 1 | 98° | 30 sec | 1X | |
| Step 2 | 98° | 10 sec | 7X | |
| 68 ° | 30 sec | |||
| 72° | 30 sec | |||
| Step 3 | 72° | 5 min | 1X | |
| Step 4 | 4° | Hold |
2- Pool the 10 reactions and purify the PCR product using the QIAquick PCR Purification Kit, following the manufacturer’s instructions. Elute in 20 µL of nuclease-free (ddH₂O) water.
3- Run the PCR product on a 2% agarose gel and excise the 241 bp band. Purify the DNA using the Qiagen Gel Extraction Kit, following the manufacturer’s instructions. Elute in 50 µL of nuclease-free (ddH₂O) water.
4- Perform a second PCR using all the product from PCR1:
Primers for PCR2:
| A | B | |
| Sequence | ||
| BE_Sensor_Fwd | TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG | |
| BE_Sensor_PCR2_1_Rev | ATTTGTCTCAAGATCTAGTTACGCCAAGCTTCAGAAGACGGCATACGAGATCTATAGCTTCACCTTGCTACGTCGTGTGCTCTTCCGATCT |
PCR2 reaction – Amplify the PCR2 reaction in 10 tubes:
| A | B | C | |
| Volume (ul) | 10X volume (ul) | ||
| PCR1 product from gel extraction | 5 | 50 | |
| NEBNext Ultra II Q5 Master Mix (E7805L) | 10 | 100 | |
| PCR2 forward primer (10uM) | 1 | 10 | |
| PCR2 reverse primer (10uM) | 1 | 10 | |
| dd H2O | 3 | 30 | |
| Total volume | 20 | 200 |
Cycling:
| A | B | C | D | |
| Temp | Time | Cycles | ||
| Step 1 | 98° | 30 sec | 1X | |
| Step 2 | 98° | 10 sec | 10X | |
| 70° | 30 sec | |||
| 72° | 30 sec | |||
| Step 3 | 72° | 5 min | 1X | |
| Step 4 | 4° | Hold |
5- Pool the 10 PCR reactions and purify the product using a PCR purification column, as previously described. Run the purified product on a 2% agarose gel and excise the 299 bp band. Perform gel extraction using the Qiagen Gel Extraction Kit, following the manufacturer's instructions. Elute in 20 µL of nuclease-free (ddH₂O) water.
Vector preparation
Restriction Digest of pHKO9-BsmBI library backbone.
1- Add components in the following order:
| Volume (ul) | ||
| pHKO9-BsmBI (10ug) | 15 | |
| dd H2O | 65 | |
| rCutsmart | 10 | |
| DTT (20mM) | 5 | |
| BsmBI | 5 |
2- Incubate at 37 °C for 1 hour.
3- Run 1% agarose gel and isolate 8kb band by gel extraction (as described previously).
Gibson assembly:
1- Set up the following reaction on ice:
| A | B | |
| Volume (ul) | ||
| Gibson Assembly Master Mix (2X) (E5510) | 10 | |
| pHKO9-BsmBI (350ng/ul) | 1 | |
| PCR2 product from gel extraction (75ng/ul) | 0.7 | |
| dd H2O | 8.3 | |
| Total Volume | 20 |
2- Incubate samples in a thermocycler at 50°C for 1 hour
Perform isopropanol precipitation:
| Volume (ul) | ||
| Gibson reaction mix | 20 | |
| Isopropanol | 20 | |
| GlycoBlue | 0.4 | |
| 5M NaCl | 0.4 |
- Vortex, incubate at room temperature for 15 min.
- Centrifuge at top speed for 15 min.
- Carefully remove liquid without disturbing the pellet.
- Wash twice with 1 mL of ice-cold 80% EtOH.
- Carefully remove all liquid, and air-dry pellet for 2-3 min by keeping the cap open at room temperature.
- Add 6 µL ddH₂O and warm at 55°C for 10 min to fully resuspend.
Electroporation Protocol
1. Transformation
Add 2 µL of Gibson assembly product (~50 ng) to 25 µL of Lucigen Endura electrocompetent cells.
Electroporate using the following settings:
- Cuvette: 1 mm
- Capacitance: 10 µF
- Resistance: 550 Ω
- Voltage: 1700 V
2. Recovery
Immediately add 1 mL of S.O.C. recovery medium to the cuvette.
Transfer to a culture tube and shake at 37 °C for 1 hour.
3. Dilution and Plating
- Prepare a 1:1000 dilution by adding 10 µL of the recovered culture to 990 µL of LB.
- Plate 100 µL of this dilution (i.e., a 1:10,000 final dilution) onto an agar plate.
- Incubate the plate overnight at 37 °C.
4. Library Expansion
- Incubate the remaining 990 µL of the undiluted culture in 50 mL of LB broth.
- Grow overnight at 37 °C with shaking.
5. Colony Counting & Cloning Efficiency
- Count the colonies on the 1:10,000 dilution plate.
- Subtract any colonies observed on the negative control plate (no insert) to assess cloning efficiency.
- Estimate total colony count by multiplying by the dilution factor.
- Goal: Achieve ≥20× coverage of your library.
6. Plasmid Extraction
- If coverage requirements are met, proceed with a Midiprep on the overnight bacterial culture.
Sequencing and QC
Sequencing was performed at the Centre d’expertise et de services Génome Québec, located at CHU Sainte-Justine. Libraries were sequenced on an Illumina NovaSeq PE150 platform, targeting a read coverage of more than 500 reads per sgRNA per sample.
TeloHAEC Thawing
For each vial, prepare a 15 mL tube with 10 mL of warm complete VCBM media supplemented with 0.15 µg/mL puromycin and P/S.
Vascular Cell Basal MediumCedarlaneCatalog #PSC-100-030 Vascular Endothelial cell growth kit-VEGFCedarlaneCatalog #PSC-100-041 Puromycin dihydrochloride Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9620-10ML
pen/strep 100X, 100mLWisent BioproductsCatalog #450-201-EL
Take a cryovial of cells out of liquid nitrogen storage and thaw in a 37°C water bath until only a tiny bit of ice remains. Vials should contain 1 million cells.
Mix cells by gentle shaking, spray off the outside with 70% EtOH, flick down to bring all cells/media to the bottom of the tube, and transfer to a tissue culture (TC) hood.
Transfer the content of one vial into a prepared 15 mL tube containing 10 mL of warm complete VCBM.
Centrifuge for 5 minutes at 200g, room temperature (RT), and discard the supernatant.
Resuspend in 1 mL of complete VCBM, then count and assess viability.
Plate cells in a T75 flask with 15 mL of complete media.
T75 TC FLASK CN VENT CAP/CS100SarstedtCatalog #83.3911.002
Incubate in a sterile tissue culture incubator at 37°C with 5% CO₂, maintaining humidity by placing a pan of water at the bottom.
Allow cells to recover for 1 week before performing any assay.
TeloHAEC culture in T75 format.
Take the flask out of the incubator and aspirate the media.
Wash with 3 mL of HEPES, making sure it covers the entire surface area of the dish.
HEPES buffered saline solutionCedarlaneCatalog #CC-5024
Aspirate the HEPES.
Add 2 mL of trypsin/EDTA solution and incubate for 3 minutes.
Trypsin-EDTA for Primary cellsCedarlaneCatalog #PSC-999-003
Take the flask out of the incubator, add 2 mL of TNS, and gently shake the plate.
Trypsin neutralizing solutionCedarlaneCatalog #PSC-999-004
Transfer the cell suspension into a 15 mL tube and centrifuge at 200 g for 5 minutes at room temperature (RT).
Resuspend the pellet in 1 mL of VCBM and count the cells.
Seed 5,000 cells/cm² in complete media to reach 80% confluence within 3 days.
Freeze mix for TeloHAEC cells is complete VCBM supplemented with 10% DMSO.
HEK293FT cells culture
HEK293FT cells were purchased from ThermoFisher (Cat# R70007), thawed, split, and maintained the same as for TeloHAEC, with the following exceptions:
- Use DMEM High glucose with GlutaMAX and Sodium pyruvate + 10% premium grade FBS + 1x Penn/Strep as a growth medium.
- During passage, no need to wash cells with HEPES; simply aspirate the media and use Trypsin low EDTA express instead of Trypsin/EDTA.
- Plate at ~20,000 cells/cm² and split when they reach 80% confluence.
- Freeze mix for 293FT cells is DMEM + 30% FBS + 10% DMSO.
DMEM High glucose with glutamax and Sodium pyruvateLife TechnologiesCatalog #10569010
FBS premium grade 500ml for 293FTVWR International (Avantor)Catalog #97068-085
TRYPLE expressCedarlaneCatalog #CC-5002
Lentivirus production in T175 format
Day 0:
- Plate 80,000 cells/cm² in a T175 flask (14 million cells total) in 24.5 mL of DMEM + 10% FBS, no P/S.
- Four batches of lentivirus will be produced, so four T175 flasks were seeded with 14 million 293FT cells each.
Falcon T-175SarstedtCatalog #83.3912.002
Day 1:
A: Prepare lentiviral target mix:
In a sterile 15 ml falcon tube add:
- 1.75 mL of Opti-MEM.
- 11.9 µg of pMD2.G.
- 18.2 µg of psPAX2.
- 23.8 µg of transfer plasmid expressing the library of guide RNA and puromycin resistance.
Falcon tube 15mlThermo Fisher ScientificCatalog #1495949B
Opti-MEMLife TechnologiesCatalog #31985070
psPAX2addgeneCatalog #12260
pMD2.GaddgeneCatalog #12259
B: Prepare PLUS reagent mix:
- In another 15 mL tube, add 231 µL of PLUS reagent to 1.75 mL of Opti-MEM.
- Add the PLUS reagent mix to the lentiviral target mix in A, mix by inverting three times, and incubate at room temperature for 5 minutes.
Plus reagentLife TechnologiesCatalog #11514015
C: Prepare Lipofectamine mix:
- In another 15 mL tube, add 210 µL of Lipofectamine 2000 to 3.5 mL of Opti-MEM.
- Add the A+B mix to C (Lipofectamine mix), mix by inverting three times, and incubate at room temperature for 5 minutes.
- Add 7 mL of the final mixture to the T175 flask dropwise, ensuring the entire surface of the flask is covered.
- After 4 hours, replace the media with 40 mL of DMEM + 10% FBS + 1% BSA.
Lipofectamine 2000Life TechnologiesCatalog #11668-019
BSA Stock SolutionMiltenyi BiotecCatalog #130-091-376
Day 3:
- Transfer the media containing virus to a 50 mL Falcon tube 48 hours post-transfection.
- Centrifuge at 1,000 × g for 1 minute at room temperature.
- Filter the supernatant using a Steriflip filter unit. Keep the virus at 4 °C until ready to freeze.
- Aliquot and store at -80 °C.
Falcon tube 50 mlThermo Fisher ScientificCatalog #1443222
Millipore Steriflip sterile disposable 0.45uMThermo Fisher ScientificCatalog #SE1M003M00
Lentivirus titration
Thaw TeloHAEC cells as described above and allow them to recover for a few days in complete VCBM. Throughout the recovery period, ensure that cells are maintained below 80% confluence.
Before infection, remove the virus stock from the -80 °C freezer and thaw it slowly on ice in a biosafety level 2 (BL2) culture room.
Trypsinize and count TeloHAEC cells. Based on the cell count, distribute 2 × 10⁵ cells per well into six wells of a 6-well plate. Ensure that the cell suspension volume per well is ≤ 800 µL.
Additionally, prepare one extra control well that will not undergo selection.
Tissue culture plate 6 wells FalconVWR International (Avantor)Catalog #CA62406-161
Example of volumes of cells, medium, virus and polybrene needed for a virus titration in a 6-well plate
| A | B | C | D | E | |
| Well ID | Cell suspension (ul) | VCBM compl. | Virus (ul) | Polybrene (ul) | |
| 1 | 800 | 300 | 0 | 1 | |
| 2 | 800 | 290 | 10 | 1 | |
| 3 | 800 | 270 | 30 | 1 | |
| 4 | 800 | 210 | 90 | 1 | |
| 5 | 800 | 30 | 270 | 1 | |
| 6 | 800 | 0 | 600 | 1 |
polybrene (hexadimethrine bromide)Merck MilliporeSigma (Sigma-Aldrich)Catalog #H9268-5G
The next day, passage the cells into a larger culture dish and replace the medium with VCBM complete media supplemented with penicillin/streptomycin (p/s) and 8 µg/mL puromycin to begin selection. For the control well (no virus), maintain cells in regular VCBM complete media without puromycin.
It is crucial to retain all cells or split them equally across all conditions, as this step is essential for accurate calculation of the multiplicity of infection (M.O.I.).
The puromycin concentration (8 µg/mL) was established by performing a kill curve on TeloHAEC cells.
Selection duration is defined as the number of days required to completely eliminate all cells in the control well (without virus); in this case, it is 6 days.
After the selection period:
- Trypsinize the cells and perform a cell count.
- Plot a curve with:
X-axis: Volume of virus used
Y-axis: Number of cells that survived selection
3. Use the resulting curve to determine the volume (or approximate volume) of virus that results in ~30% cell survival, relative to the unselected control well. This volume of virus, when used to infect 2 × 10⁵ cells, corresponds to an MOI of 0.3. Scale up accordingly if a larger number of cells is to be infected.
Generate TeloHAEC-SFFV-ABE8e cell line
The TeloHAEC model expressing dCas9-SFFV-ABE8e-Blast was generated via lentiviral transduction (as described above) using the pLenti-SFFV-ABE8e-(D10A) SpRY-P2A-Blast vector. Transduction of wild-type TeloHAEC cells (TeloHAEC-WT) was performed to establish a stable cell line expressing the ABE8e base editor. Transduced cells were subjected to selection with 5 µg/mL blasticidin for 7 days. Expression of the ABE8e-(D10A) SpRY-P2A-Blast protein in the resulting population was subsequently confirmed by Western blot analysis.
The maintenance medium for the TeloHAEC-SFFV-ABE8e cell line consists of Complete VCBM supplemented with penicillin/streptomycin, 0.15 µg/mL puromycin, and 2.5 µg/mL blasticidin.
Pooled ABE screen for scRNA-seq
TeloHAEC-SFFV-ABE8e cells were thawed from liquid nitrogen storage and passaged twice prior to infection, as described above. Briefly, cells were seeded into four T225 culture flasks, each containing 5 million cells in 26.75 mL of VCBM supplemented with 25 µL of polybrene (1 mg/mL). Infection was performed using the volume of virus corresponding to an MOI of 0.3, as determined by prior titration. These four flasks were prepared to allow for subsequent TNF-α treatment (10 ng/mL for 4 hours) in two flasks, with the remaining two flasks serving as untreated controls.
After 24 hours of infection, cells were subjected to selection with 8 µg/mL puromycin for 14 days in complete VCBM supplemented with penicillin/streptomycin (p/s). Throughout the selection period, cultures were maintained below 80% confluence.
At the end of the selection period, two flasks of cells were treated with 10 ng/mL of TNF-α for 4 hours, while two additional flasks were kept as untreated controls. Following treatment, cells were trypsinized, counted, centrifuged, and resuspended in PBS containing 0.04% BSA to achieve a final concentration of 1,500 cells/µL.
Cells were then loaded into the 10x Chromium instrument following the manufacturer’s protocol (Chromium GEM-X Single Cell 5' Reagent Kits v3 with Feature Barcode technology for CRISPR screening). A total of four lanes on the 10x chip were loaded, corresponding to the four conditions (two controls and two TNF-α–treated samples). Each lane was loaded with 29,000 cells, targeting a recovery of 20,000 cells per condition.
After GEM generation, reverse transcription, library construction, and quality control (QC) were performed according to the manufacturer’s instructions.
Sequencing
Eight libraries were generated using the 10x Genomics protocol described above: four gene expression libraries, one for each condition, and four corresponding CRISPR libraries capturing the gRNAs. The libraries were pooled such that the gene expression libraries received four times more sequencing reads than the CRISPR libraries.
Sequencing was carried out at the Centre d’expertise et de services Génome Québec, located at CHU Sainte-Justine, using an Illumina NovaSeq PE100 platform. A total of 3,200 million reads were generated, targeting a read depth of over 20,000 reads per cell for the gene expression libraries and 5,000 reads per cell for the CRISPR libraries.