Feb 10, 2023

PCR-NGS for RNA viruses

DOI
https://dx.doi.org/10.17504/protocols.io.x54v9d361g3e/v1
PCR-NGS for RNA viruses
  • Masayasu Misu1,2,
  • Tomoki Yoshikawa1,
  • Satoko Sugimoto1,
  • Yuki Takamatsu1,
  • Takeshi Kurosu1,
  • Yukiteru Ouji2,
  • Masahide Yoshikawa2,
  • Masayuki Shimojima1,
  • Hideki Ebihara1,
  • Masayuki Saijo1
  • 1Department of Virology I, National Institute of Infectious Diseases;
  • 2Department of Pathogen, Infection and Immunity, Nara Medical University
Masayasu Misu
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.x54v9d361g3e/v1
Protocol Citation: Masayasu Misu, Tomoki Yoshikawa, Satoko Sugimoto, Yuki Takamatsu, Takeshi Kurosu, Yukiteru Ouji, Masahide Yoshikawa, Masayuki Shimojima, Hideki Ebihara, Masayuki Saijo 2023. PCR-NGS for RNA viruses. protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9d361g3e/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 27, 2023
Last Modified: February 10, 2023
Protocol  Integer ID: 75970
Keywords: Oxford Nanopore Technology, RNA virus, Sequence method, MinION, Nanopore sequencing, cDNA-PCRseq, PCR-NGS, ngs for rna virus, viral genome sequence determination, whole rna viral genome, terminal of viral genome sequence determination, viral genome by nuclease treatment, viral genome, nucleic acid amplification with virus, amplification of the viral genomic cdna, viral genomic cdna, rna virus, physical viral particle enrichment, specific pcr primer, whole rna, segmented genome, pcr, rna, nucleic acid amplification, rna other than the rna, genome, genome sequence, virus, nucleic acid, using ligated linker sequence, removal of unwanted dna, nuclease treatment, barcoded linkers ligation, linkers ligation, minion
Abstract
This PCR-NGS were optimized for an NGS machine, MinION. These methods do not require nucleic acid amplification with virus-specific PCR primers, physical viral particle enrichment, and RACE.

These methods enable whole RNA viral genome sequencing by combining the following techniques:
1) Removal of unwanted DNA and RNA other than the RNA viral genome by nuclease treatment.
2) The terminal of viral genome sequence determination by barcoded linkers ligation.
3) Amplification of the viral genomic cDNA using ligated linker sequences-specific PCR.

This method can be exploited to determine any whole RNA viral genomes (i.e., single-stranded, double-stranded, positive-stranded, negative-stranded, non-segmented or multi-segmented genomes).


Materials
  • Micrococcal Nuclease - 320,000 gel unitsNew England BiolabsCatalog #M0247S
  • High Pure Viral RNA KitRocheCatalog #11858882001
  • Turbo DNA-free KitInvitrogen - Thermo FisherCatalog #AM1907
  • NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10
  • T4 RNA Ligase 2, truncated KQ - 2,000 unitsNew England BiolabsCatalog #M0373S
  • The barcode-polyA linker DNA (e.g., The cSP6-polyA linker DNA)
  • PCR barcoding kit - Oxford Nanopore Technologies Catalog #SQK-PBK004
  • cDNA-PCR Sequencing kit - Oxford Nanopore Technologies Catalog #SQK-PCS109
  • Deoxynucleotide (dNTP) Solution MixNew England BiolabsCatalog #N0447S
  • Superase-In RNase InhibitorThermofisherCatalog #AM2694
  • Maxima H Minus Reverse Transcriptase - Life Technologies, Catalog #EP0752
  • Agencourt AMPure XPBeckman CoulterCatalog #A63880
  • KOD One PCR Master Mix - TOYOBO Catlog #KMM-101
  • Q5 Hot Start High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0494S
  • Exonuclease I Reaction Buffer - 6.0 mlNew England BiolabsCatalog #B0293S
  • Qubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
  • Qubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230
  • DNA LoBind Tube 1.5ml EppendorfCatalog #022431021
  • 0.2 ml PCR Tube stripsEppendorfCatalog #0030124359
  • 70 % ethanol
  • TE(pH8.0)
  • nuclease-free H2O




Protocol materials
High Pure Viral RNA KitRocheCatalog #11858882001
Qubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230
DNA LoBind Tube 1.5ml EppendorfCatalog #022431021
Agencourt AMPure XPBeckman CoulterCatalog #A63880
Q5 Hot Start High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0494S
Exonuclease I Reaction Buffer - 6.0 mlNew England BiolabsCatalog #B0293S
Micrococcal Nuclease - 320,000 gel unitsNew England BiolabsCatalog #M0247S
0.2 ml PCR Tube stripsEppendorfCatalog #0030124359
Turbo DNA-free KitInvitrogen - Thermo FisherCatalog #AM1907
T4 RNA Ligase 2, truncated KQ - 2,000 unitsNew England BiolabsCatalog #M0373S
Deoxynucleotide (dNTP) Solution MixNew England BiolabsCatalog #N0447S
Superase-In RNase InhibitorThermofisherCatalog #AM2694
Qubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
Exonuclease I (E.coli) - 3,000 unitsNew England BiolabsCatalog #M0293S
Safety warnings
Follow your facility's regulations and biosafety practices.
Before start
This method was only confirmed to work with the working stocks that contain isolated RNA viruses at least 3.0 × 105 TCID50 per ml.
It is recommended to check no bacterial contamination(e.g., Mycoplasma spp.).
Preparation for virus supernatant
Centrifuge the working stock virus to remove debris.
6000 x g, Room temperature, 00:10:00

10m
Transfer 180 µL virus supernatant to a 1.5ml screw cap tube.
Unwanted DNA and RNA mainly originating from the virus-infected cells are digested usingMicrococcal Nuclease - 320,000 gel unitsNew England BiolabsCatalog #M0247S .
Total 201 μl reaction

  • 180 µL virus supernatant
  • 20 µL 10X Micrococcal Nuclease Reaction Buffer
  • 1 µL Micrococcal nuclease

Mix by pipetting and spin down.
37 °C water bath 01:00:00


1h
The viral RNA extraction
The viral genomic RNA extraction is performed using High Pure Viral RNA KitRocheCatalog #11858882001 .
Add 400 µL of binding buffer (with 4 µL PolyA carrier RNA).

Mix gently by ~5 times pipetting and flicking thoroughly the tube, and spin down.
Room temperature 00:10:00
10m
Transfer the sample to a High Pure Filter Tube.
8000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
1m
Add 500 µL of inhibitor removal bo transfer the sample to a High Pure Filter Tube.
8000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
1m
Add 450 µL of wash buffer.
8000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
1m
Add 450 µL of wash buffer.
13000 x g, Room temperature, 00:01:00 and discard the flow-through liquid.

Discard the Collection Tube and insert the Filter Tube into a 1.5 ml tube(DNA LoBind Tube 1.5ml EppendorfCatalog #022431021 ).
1m
Add 50 µL Elution Buffer.
13000 x g, Room temperature, 00:01:00

Note
The eluted RNA can be stored at -80℃.

1m
Remove unwanted DNA
Unwanted DNA mainly from the virus-infected cells in the RNA sample is digested using a Turbo DNA-free KitInvitrogen - Thermo FisherCatalog #AM1907 .
Total 56 μl reaction

  • 50 µL the eluted RNA
  • 5 µL 10X reaction buffer
  • 1 µL DNase I

Mix gently by pipetting and spin down.
37 °C 00:30:00
30m
The viral RNA is purified using NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10.
Add equal volume 56 µL of Buffer RCU and mix gently.
Transfer the sample to a NucleoSpin RNA XS Column.
11000 x g, Room temperature, 00:01:00
1m
Wash the column by 400 µL Buffer RA3.
11000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the NucleoSpin RNA XS Column into a new Collection Tube.
1m
Wash the column by 200 µL Buffer RA3.
11000 x g, Room temperature, 00:02:00

Discard the flow-through liquid and Collection Tube, and insert the NucleoSpin RNA XS Column into a Nuclease-free Collection Tube(1.5 ml).
2m
Add 10 µL RNase-free H2O.
11000 x g, Room temperature, 00:01:00
Transfer the sample to a 0.2 ml PCR tube -0.2 ml PCR Tube stripsEppendorfCatalog #0030124359 .
1m
cSP6-polyA Linker DNA ligation

The viral RNA is ligated with cSP6-polyA Linker DNA usingT4 RNA Ligase 2, truncated KQ - 2,000 unitsNew England BiolabsCatalog #M0373S .
  • The RNA is ligated to the 3' end with the barcoded(complementary sequence of SP6 (cSP6)) polyA linker DNA. It is able to identify the 3’ terminal viral genome sequence. The PolyA sequence is required for reverse transcription for ONT kit (SQK-SQK-PBK004/PCS109).
Note
The cSP6-polyA linker DNA (5'-5rApp-CTATAGTGTCACCTAAATCAAAAAAAAAAAAAAAAAAAA-3ddC-3'), which is pre-adenylated at the 5' terminal (5rApp), and consists of the complementary sequence of SP6 (CTATAGTGTCACCTAAATC), oligo (dA) 20, and dideoxycytidine (3ddC) at the 3' terminal, was synthesised for 3' linker ligation by Integrated DNA Technologies (Coralville, IA).




Total 20 μl reaction

  • 10 µL Purified RNA
  • 1 µL 10 μM the cSP6-polyA linker DNA
  • 2 µL 10X T4 RNA Ligase Reaction Buffer
  • 6 µL 50% PEG8000 solution
  • 1 µL T4 RNA Ligase 2, truncated KQ

Mix gently by pipetting and spin down.
Incubation 25 °C 00:15:00

15m
The viral RNA purification by NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10.

Fill the sample to 100 μl with 80 μl TE (pH 8.0) and add 100 μl (equal volume) of Buffer RCU.

Eluted by 10 μl of RNase-free H2O and transfer the sample to a 0.2 ml PCR tube.
Reverse transcription with strand-switching, SQK-PBK004/ PCS109
The viral RNA is reverse transcribed using Maxima H Minus Reverse Transcriptase - Life Technologies, Catalog #EP0752, PCR barcoding kit - Oxford Nanopore Technologies Catalog #SQK-PBK004, cDNA-PCR Sequencing kit - Oxford Nanopore Technologies Catalog #SQK-PCS109.

The following protocol is modified based on the cDNA-PCR Sequencing protocol (PCSB_9086_v109_revK_14Aug2019) provided by Oxford Nanopore Technologies website.

Note
<cDNA-PCR Sequencing kit (SQK-PCS109)>
RT primer and strand-switching primer
  • VN primer (VNP): 5' - 5phos/ ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN - 3'
Where V = A, C, or G, and N = A, C, G, or T

  • Strand-Switching Primer(SSP): 5' - TTTCTGTTGGTGCTGATATTGCT mGmGmG - 3'


Set up pre-mixture 1

  • 9 µL RNA (~ 50ng)
  • 1 µL VN primer (VNP)
  • 1 µL 10mM dNTP - Deoxynucleotide (dNTP) Solution MixNew England BiolabsCatalog #N0447S

Mix gently by flicking the tube, and spin down.
65 °C 00:05:00 and 4 °C on ice 00:01:00


6m
Set up pre-mixture 2

  • 11 µL pre-mixture 1
  • 4 µL 5X RT buffer
  • 1 µL nuclease-free H2O
  • 1 µL RNase OUT - Superase-In RNase InhibitorThermofisherCatalog #AM2694
  • 2 µL Strand-Switching Primer(SSP)

Mix gently by flicking the tube, and spin down.
42 °C 00:02:00


2m
Add 1 µL Maxima H Minus Reverse Transcriptase and mix gently by flicking the tube, and spin down. (Total 20 μl reaction).

42 °C 01:30:00
85 °C 00:05:00


1h 35m
PCR with barcoding
33m 20s
PCR enzyme;
KOD One PCR Master Mix - TOYOBO Catlog #KMM-101
or
Q5 Hot Start High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0494S


PCR reaction is as follows:

  • 5 µL cDNA
  • 3 µL LWB (barcoding primer)
  • 42 µL nuclease-free water
  • 50 µL PCR enzyme (KOD One / Q5)
The reaction mix should be aliquoted in appropriate portions in accordance with the PCR machine used.

<KOD One PCR Master Mix>
Step Temperature Time
Heat Activation 98 °C 00:00:15

30 cycles of 3 steps
Denaturation 98 °C 00:00:10
Annealing 62 °C 00:00:05
Extension 68 °C 35sec or 5 sec/kb
68 °C 00:02:00

Note
A 35 sec extension is used for viruses with a genome size of less than 7 kb/segment, whereas a 5 sec/kb is employed in other cases.


<Q5 Hot Start High-Fidelity 2X Master Mix>
Step Temperature Time
Heat Activation 98 °C 00:00:30

30 cycles of 3 steps
Denaturation 98 °C 00:00:10
Annealing 72 °C 00:00:10
Extension 72 °C 40 sec/kb
72 °C 00:02:00


5m 20s
Add 1 µL X 2 tube Exonuclease I (E.coli) - 3,000 unitsNew England BiolabsCatalog #M0293S .

37 °C 00:15:00
80 °C 00:15:00
30m
The PCR product is purified using Agencourt AMPure XPBeckman CoulterCatalog #A63880 .
Prepare AMpure XP reagent for use; resuspend by vortexing.
Transfer amplified DNA sample to 1.5ml low binding tube.

Add 80 µL (X 0.8 volume) AMPure XP reagent and mix by pipetting.
Incubate on rotor mixer.
00:05:00 Room temperature

5m
Spin down and pellet on a magnet. Wait for 00:01:00 and pipette off the supernatant.
1m
Wash three times by 200 µL 70 % ethanol and remove the ethanol using a pipette and discard.
Spin down and pipette off any residual ethanol.
  • Resuspend pellet in 12 µL Elution Buffer (EB).
37 °C 00:03:00 and tapping occasionally.
Incubate on rotor mixer.
00:07:00
10m
Spin down and pellet the beads on the magnet until the elute is clear and colourless.
Remove retain 12 µL elute into a new tube.

DNA concentration is measured using a Qubit 4 Fluorometer with Qubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230 .

  • 199 µL 1X working solution
  • 1 µL DNA

Mix by vortexing.

Incubate 00:02:00 Room temperature and measure.

Note
The molar quantity of cDNA in the sample can be converted from the concentration through the utilization of the viral genome length or the mean viral genome length if the viral genome is segmented.

2m
Adaptor Ligation
  • Add 1 µL of Rapid Adaptor (RAP)(SQK-PBK004, SQK-PCS109) to 11 µL library DNA(total approximately 100 fmol).

Mix gently and incubate Room temperature 00:05:00 .

5m
Sequencing by MinION
Sequencing according to the manufacturer's instructions.