Jan 26, 2026

Public workspaceOrbivirus (BTV, EHDV, AHSV) whole genome sequencing using a SISPA approach and nanopore technology

DOI
https://dx.doi.org/10.17504/protocols.io.e6nvw4bw7lmk/v1
  • Mathilde Gondard1,
  • Lydie Postic1,
  • Mathilde Turpaud1,
  • Stephan Zientara1,
  • Damien Vitour1,
  • Corinne Sailleau1,
  • Emmanuel Bréard1
  • 1Virologie Unit, Laboratory of animal health, ANSES, Maisons-Alfort, France
mathilde Gondard
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.e6nvw4bw7lmk/v1
Protocol Citation: Mathilde Gondard, Lydie Postic, Mathilde Turpaud, Stephan Zientara, Damien Vitour, Corinne Sailleau, Emmanuel Bréard 2026. Orbivirus (BTV, EHDV, AHSV) whole genome sequencing using a SISPA approach and nanopore technology. protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvw4bw7lmk/v1
Manuscript citation:
Gondard M, Postic L, Garin E, Turpaud M, Vorimore F, Ngwa-Mbot D, Tran ML, Hoffmann B, Warembourg C, Savini G, Lorusso A, Marcacci M, Felten A, Roux AL, Blanchard Y, Zientara S, Vitour D, Sailleau C, Bréard E. Exceptional Bluetongue virus (BTV) and Epizootic hemorrhagic disease virus (EHDV) circulation in France in 2023. Virus Res. 2024 Dec;350:199489. doi: 10.1016/j.virusres.2024.199489. Epub 2024 Nov 1. PMID: 39471970; PMCID: PMC11565556.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working, and we are currently working on optimizations.
Created: September 03, 2025
Last Modified: January 26, 2026
Protocol Integer ID: 226338
Keywords: Whole genome sequencing, orbiviruse, BTV, EHDV, AHSV, minion, SISPA, important orbiviruses from clinical sample, important orbivirus, isolates of bluetongue virus, orbivirus, bluetongue virus, isolates of african horse sickness virus, hemorrhagic virus, african horse sickness virus, epizootic hemorrhagic virus, btv, oxford nanopore, nanopore technology this protocol, nanopore technology, ehdv
Funders Acknowledgements:
PREPMEDVET project
Grant ID: ANR-20-SEBM-0004
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those oftheir affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that maybe evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed bythe publisher.
Abstract
This protocol describes a SISPA (Sequence-Independent Single Primer Amplification) approach combined with Oxford Nanopore sequencing for the detection and characterization of three economically most important orbiviruses from clinical samples or isolates.
This protocol has been validated on field samples and isolates of Bluetongue Virus (BTV) and Epizootic hemorrhagic virus (EHDV), and on isolates of African Horse Sickness virus (AHSV).
We hope this will be useful for other teams working on orbiviruses. Feel free to reuse, adapt, or cite this protocol using the DOI provided.
Materials
1. Materials for sample preparation

  • RNA eluted in Nuclease free water (be careful if using commercial kit or automate)
  • Group specific real-time RT-PCR (rtRT-PCR) assay
Example:
-- Pan-BTV (Segment 10): commercial real-time RT-PCR (rtRT-PCR) kit mix (ADI-352, Bio-X Diagnostics S.A., Ploufragan, France).
-- Pan-EHDV (segment 9): Viarouge et al., 2015 (1)
-- Pan-AHSV (segment 7): Quan et al., 2010 (2)
  • NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) with RNA Sample Purification Beads (E6350L, New England Biolabs, USA) (note: kit may include Agencourt RNAClean XP or NEBNext RNA Sample Purification Beads; if not, order separately)
  • SuperScript™ IV Reverse Transcriptase, Invitrogen™ (18090010, Life Technologies, USA) (200 U/µL)
  • RNaseOUT™ Recombinant Ribonuclease Inhibitor 40 U/µL, Invitrogen™ (10777019, Life Technologies, USA)
  • dNTP mix, 10 mM each (N0447S, New England Biolabs, USA)
  • Klenow Fragment (3'→5' exo-) / 3'-5' Klenow Polymerase (2.5 U)
  • Q5® Hot Start High-Fidelity DNA Polymerase (M0493S, New England Biolabs, USA)
  • HighPrep™ PCR Clean-up System (AC-60050, MagBio Genomics Inc, USA)
  • Qubit™ dsDNA high sensitivity (HS), Invitrogen™ (Q32851, Life Technologies, USA)
  • Genomic DNA ScreenTape kit (Agilent Technologies, USA)
  • Freshly prepared 80% ethanol in nuclease-free water
  • Nuclease free water
  • SISPA primers (both random and orbivirus-specific primers)

ABC
Primers name Sequences 5’-3’ Reference
FR26RV-N (50 µM) GCCGGAGCTCTGCAGATATCNNNNNNN Djikeng et al., 2008 (3)
FR-BT_F (10 µM) GCCGGAGCTCTGCAGATATCGTTAAAN Marcacci et al., 2016 (4), Sghaier et al., 2022 (5)
FR-BT_R (10 µM) GCCGGAGCTCTGCAGATATCGTAAGTN Marcacci et al., 2016 (4), Sghaier et al., 2022 (5)
FR20 Rv (40µM) GCCGGAGCTCTGCAGATATC Djikeng et al., 2008 (3)

2. Materials for nanopore library preparation

  • 200-300 fmol (130 ng for 1 kb amplicons) DNA per sample to be barcoded
  • Native Barcoding Kit 24 V14 (SQK-NBD114.24, Oxford Nanopore)
  • Sequencing Auxiliary Vials V14 (EXP-AUX003, Oxford Nanopore)
  • Native Barcoding Expansion V14 (EXP-NBA114, Oxford Nanopore)
  • R10.4.1 flow cells (FLO-MIN114)
  • Flow Cell Wash Kit (EXP-WSH004)
  • NEB Blunt/TA Ligase Master Mix (M0367T, New England Biolabs, USA)
  • NEB Next Ultra II End repair/dA-tailing Module (E7546, New England Biolabs, USA)
  • NEB Next Quick Ligation Module (E6056, New England Biolabs, USA)
  • Qubit™ dsDNA high sensitivity (HS), Invitrogen™ (Q32851, Life Technologies, USA)
  • Freshly prepared 80% ethanol in nuclease-free water
  • Nuclease free water

3. Equipment (listed in document)

  • Pipettes and pipette tips with filters P2, P3, P10, P20, P100, P200, P1000
  • Plastic consumables (Eppendorf DNA LoBind tubes, plates, microtubes...)
  • Conventional and real-time Thermal cycler
  • Microfuge, vortex mixer
  • Ice bucket with ice
  • Dry bath / Heating block capable of 25°C, 37°C, 65°C
  • Magnetic separator, suitable for 1.5 mL Eppendorf tubes (Magnarack, CS15000, Life Technologies, USA)
  • Qubit® 2.0 Fluorometer (or later)
  • Qubit™ Assay Tubes Invitrogen™ (Q32856, Life Technologies, USA)
  • 2200 TapeStation instrument (Agilent Technologies, USA)
  • Note: MinION libraries are prepared using NBD114.24 kit and following the manual version with somemodifications: "ligation-sequencing-amplicons-native-barcoding-v14-sqk-nbd114-24-NBA9168v114revL15Sep2022-minion"
  • MinION or GridION device (with lid and clip to seat flow cell)
  • Light shield for flow cell (installed after loading for optimal sequencing output)

Troubleshooting
Before start
Checklist - See '1. Materials for sample preparation' and '2. Materials for nanopore library preparation' for items toprepare before starting.
RNA input
RNA should be eluted in nuclease-free water instead of other commercial elution buffer(with content that might interfere with NGS preparation protocols, such as EDTA).
Optional: Validate RNA samples using group specific real-time RT-PCR assay.
Ribosomal RNA depletion – Probe Hybridization
20m
Comment: rRNA depletion is advised when working with host matrices rich in ribosomal RNA.
Comment: This step uses the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat). For updated versions, follow the manufacturer's instructions.
Prepare Probe Hybridization (PH) reaction mix as described below, for the number of samples to be prepared allowing for at least two extra samples.
AB
Reagent Quantity
NEBNext rRNA Depletion Solution 1 μl
Probe Hybridization Buffer 2 μl

Add 3 µL of PH reaction mix to 12 µL of RNA (5 ng – 1 µg of RNA).
Mix by pipetting, close the tube and spin down quickly.
Incubate Duration00:15:00 at TemperatureRoom temperature .
15m
Add 1 µL of EDTA 25 mM to inactivate the reaction.
Using a thermal cycler, incubate:
  • Heated lid to Temperature105 °C
  • Temperature95 °C to Temperature22 °C – temperature decrease of 0.1°C/sec
  • Temperature22 °C for Duration00:05:00
  • Temperature4 °C - hold.
Spin down, place RNA samples on ice and move on quickly to the next step.
Ribosomal RNA depletion – RNase H Digestion
30m
Prepare RNase H (RH) reaction mix as described below, for the number of samples to be prepared allowing for at least two extra samples.
AB
Reagent Quantity
NEBNext RNase H 1 μl
RNase H Reaction Buffer 2 μl
Nuclease-free Water 1 μl

Add 5 µL of RH reaction mix to the RNA from the previous step.
Mix by pipetting, close the tube and spin down quickly.
Using a thermal cycler, incubate:
  • Heated lid off (or Temperature40 °C )
  • Temperature37 °C for Duration00:30:00
  • Temperature4 °C - hold
Spin down, place RNA samples on ice and move on quickly to the next step.
Ribosomal RNA depletion – DNase I Digestion
30m
Prepare DNase I (DI) reaction mix as described below, for the number of samples to be prepared allowing for at least two extra samples.

AB
Reagent Quantity
DNase I Reaction Buffer 5 μl
DNase I (RNase-free) 2.5 μl
Nuclease-free Water 22.5 μl

Add 30 µL of DI reaction mix to the RNA from the previous step.
Mix by pipetting, close the tube and spin down quickly.
Using a thermal cycler, incubate:
  • Heated lid off (or Temperature40 °C )
  • Temperature37 °C for Duration00:30:00
  • Temperature4 °C - hold
30m
Spin down, place RNA samples on ice and move on quickly to the next step.
RNA purification
28m
Comment: The NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) includes either Agencourt RNAClean XP Beads or NEBNext RNA Sample Purification Beads; if not, they should be ordered separately.
Vortex RNA sample purification beads to resuspend.
Add 110 µl (2.2X) of purification beads to the RNA sample. Mix well by pipetting up and down at least 10 times, close the tube and spin down quickly.
Incubate samples TemperatureOn ice for Duration00:15:00 .
15m
Place the tube/plate on an appropriate magnetic stand to separate the beads from the supernatant. If necessary, quickly spin the sample to collect the liquid from the sides of the tube or plate wells before placing on the magnetic stand.
After Duration00:05:00 (or when the solution is clear), carefully remove and discard the supernatant. Be careful not to disturb the beads that contain the RNA.
5m
Add 200 µl of 80% freshly prepared ethanol to the tube/plate while in the magnetic stand. Incubate at room temperature forDuration00:00:30 , and then carefully remove and discard the supernatant. Be careful not to disturb the beads that contain the RNA.
30s
Repeat the washing step: add 200 µl of 80% freshly prepared ethanol to the tube/plate while in the magnetic stand. Incubate at room temperature for Duration00:00:30 , and then carefully remove and discard the supernatant.
30s
Air dry the beads for up to Duration00:05:00 while the tube/plate is on the magnetic stand with the lid open; do not over-dry the beads. Elute the samples when the beads are still dark brown and glossy looking, but when all visible liquid has evaporated.
5m
Remove the tube/plate from the magnetic stand. Elute the RNA from the beads by adding 12 µl of nuclease-free water. Mix well by pipetting up and down 10 times.
Incubate for at least Duration00:02:00 . If necessary, quickly spin the sample to collect the liquid from the sides of the tube or plate wells before placing back on the magnetic stand.
2m
Place the tube/plate on the magnetic stand. After 5 minutes (or when the solution is clear), transfer 10 µl to a new PCR tube.
Place the tube TemperatureOn ice and proceed with downstream application. Alternatively, the sample can be stored at Temperature-80 °C .
RNA DENATURATION
8m
Thermal denaturation of the double stranded RNA genome using a thermal cycler, incubate:
  • Temperature95 °C for Duration00:05:00
  • Temperature4 °C for Duration00:03:00 (or place TemperatureOn ice ).
8m
Place RNA samples TemperatureOn ice and move on quickly to the next step.
SISPA preparation, Reverse Transcription
1h 17m
Prepare RT1 reaction mix as described below, for the number of samples to be prepared allowing for at least two extra samples.

ABC
Reagent Quantity Final concentration
10 mM dNTP mix (10 mM each) 1 μl 0.25 mM
FR26RV-N (50 μM) 1 μl 2.5 µM
FR-BT_F (10 µM) 1 μl 0,5 μM
FR-BT_R (10 µM)         1 μl 0,5 μM

Add 4 µL of RT1 reaction mix to the RNA sample, mix and briefly centrifuge the components.
Using a thermal cycler, incubate:
  • Temperature65 °C for Duration00:05:00
  • Temperature4 °C for Duration00:02:00
7m
Place RNA sample TemperatureOn ice and move on quickly to the next step.
Prepare RT2 reaction mix as described below, for the number of samples to be prepared allowing for at least two extra samples.

ABC
Reagent for RT2 reaction mix Quantity Final concentration
SSIV Buffer 5X (heated at +37°C) 4 μL 1X
DTT (100 mM) 1 μL 5 mM
RNaseOUT‱ Recombinant RNase Inhibitor (40 U/µL) 1 μL 40 U
SuperScript‱ IV Reverse Transcriptase (200 U/μL) 1 µL 200 U
Add 7 µL of RT2 reaction mix to the annealed RNA.
Mix, and then briefly centrifuge the contents.
Using a thermal cycler, incubate:
  • Temperature23 °C for Duration00:10:00
  • Temperature53 °C forDuration00:50:00
  • Temperature80 °C for Duration00:10:00
  • Temperature4 °C - Hold.
1h 10m
Move on quickly to the next step.
SISPA preparation, cDNA Second Strand Synthesis
1h 10m
Add 1 µL of 3'-5' Klenow Polymerase (2.5 U) directly to the sample.
Mix by pipetting, close the tube and spin down.
Using a thermal cycler, incubate:
  • Temperature37 °C for Duration01:00:00
  • Temperature75 °C for Duration00:10:00
  • Temperature16 °C - Hold
1h 10m
Tenfold dilution of the ds cDNA sample:
  • 3 µL ds cDNA
  • 27 µL Nuclease free water
Comment: The tenfold dilution is essential to avoid PCR inhibition. Alternatively, you can purify your sample.
Safe stop – short term conservation at Temperature4 °C , long term conservation at Temperature-80 °C or Temperature-20 °C .

SISPA preparation, labeled DNA amplification
9m 40s
Prepare PCR reaction mix as described below, for the number of samples to be prepared allowing for at least two extra samples.
ABC
Reagent Quantity Final concentration
Nuclease-free water 32.5 μL /
Q5 Reaction Buffer 5X 10 μL 1X
dNTP mix (10 mM each) 1 μL 0.25 mM each
Primer FR20-Rv (40 µM) 1 μL 0.8 mM
Q5 Hot Start High-Fidelity DNA Polymerase 0.5 μL 0.02 U
Distribute 45 µL of PCR reaction mix per sample.
Add 5 µL of tenfold diluted ds cDNA (or nuclease-free water for negative PCR control).
Mix by pipetting, close the tube and spin down.
Using a thermal cycler, incubate:
  • Temperature98 °C for Duration00:01:00
  • 40 cycles:
Temperature98 °C for Duration00:00:10
Temperature65 °C for Duration00:00:30
Temperature72 °C forDuration00:03:00
  • Temperature72 °C for Duration00:05:00
  • Temperature16 °C – Hold
9m 40s
Move on quickly to the next step.
Comment: Before the purification step, which is expensive, you can control the concentration of the diluted ds cDNA and your fresh amplicon using Qubit and Qubit‱ ds DNA high sensitivity (HS), Invitrogen‱ (ThermoFisher, Q32851) kit.
Amplicon Clean-up & quantification
18m
Resuspend the beads by vortexing.
Add 90 µL of beads (ratio 1.8X) to the sample and mix by pipetting (ten times).
Incubate Duration00:05:00 at TemperatureRoom temperature .
5m
Spin down the sample and pellet on a magnet rack until supernatant is clear and colorless (at least Duration00:05:00 ).
5m
Pipette off the supernatant.
Add 200 µL of freshly prepared 80% ethanol without disturbing the pellet.
Incubate Duration00:00:30 .
30s
Remove the ethanol and discard.
Repeat the washing step by adding again 200 µL of freshly prepared 80% ethanol without disturbing the pellet; incubate Duration00:00:30 and remove the ethanol.
30s
Spin down and place the tube back on the magnet, pipette off any residual ethanol using P10.
Allow to dry, but do not dry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend pellet in 27 µL of nuclease-free water.
Incubate for Duration00:02:00 at TemperatureRoom temperature .
2m
Pellet the beads on a magnet until the eluate is clear and colorless (at least Duration00:05:00 ).
5m
Transfer 25 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.
Quantify your sample using a Qubit fluorometer and the Qubit™ ds DNA high sensitivity (HS) kit.
Check the amplicon size distribution of your sample and determine the average size (value used during library preparation input quantity calculation).
Optional: Quantify your sample using specific real time PCR to check viral enrichment.
Comment: Volume of elution can be adapted according to the input required for library preparation.
Comment: Keep the bead ratio during the clean-up at 1.8X or 1.5X to avoid losing small DNA fragments.
Safe stop – short term conservation at Temperature4 °C , long term conservation at Temperature-80 °C or Temperature-20 °C .
Library prep – input normalization
Comment: MinION libraries are prepared using the NBD114.24 kit and following the manual version with some modifications: "ligation-sequencing-amplicons-native-barcoding-v14-sqk-nbd114-24-NBA9168v114revL15Sep2022-minion".

For the most up-to-date information on library preparation, please consult the official Oxford Nanopore Technologies documentation on their website, which includes protocols for preparing sequencing libraries with their kits. Oxford Nanopore provides a comprehensive set of library preparation protocols and updates as part of their Prepare documentation.

For detailed instructions on how to install and use the MinKNOW software and start a sequencing run, please refer to the MinKNOW documentation and user guides provided by Oxford Nanopore Technologies. These resources explain how to set up a sequencing experiment, select kits and parameters, and begin data acquisition with MinKNOW.
Comment: Approximately 120 nanopores should be active per FMDV sample following this protocol to reach a good sequencing depth and coverage.
Determine the molarity of your sample using concentration (ng/µL) and the DNA amplicon average size (bp).
  • Use the formula: Molar concentration (fmol/µL) = [(concentration (ng/µL) / (Size * 660)) * 1.106]
  • or use the online tool: https://nebiocalculator.neb.com/#!/dsdnaamt
In clean 0.2 mL thin-walled PCR tubes (or a clean 96-well plate), aliquot 300 fmol of DNA per sample.
Make up each sample to 12.5 µL using nuclease-free water. Mix gently by pipetting and spin down.
Library prep – End-pre
10m
Thaw the reagents at TemperatureRoom temperature :
  • AMPure XP Beads (AXP): mix by vortexing (beads should be at room temperature 30 minutes before use).
  • Ultra II End-pre reaction buffer: mix by vortexing (to dissolve any precipitate).

Remove the purification beads from the fridge at least 30 minutes before use.
Set the heating block to Temperature25 °C .
Prepare the NEBNext Ultra II End prep mix as described below, for the number of samples to be prepared allowing for at least three extra samples.
AB
Reagent Quantity
Ultra II End-prep reaction buffer 1.75 µL
Ultra II End-prep enzyme mix 0.75 µL
Add 2.5 µL of the NEBNext Ultra II End prep mix to the sample (300 fmoles DNA in 12.5 µL).
Ensure the components are thoroughly mixed by pipetting and spin down in a centrifuge.
Using a thermal cycler, incubate:
  • Temperature20 °C for Duration00:05:00
  • Temperature65 °C for Duration00:05:00
10m
Library prep – Clean-up & Quantification
18m
Resuspend the AMPure XP beads (AXP) by vortexing.
Add 22.5 µL (1.5X) of resuspended AMPure XP Beads (AXP) to each end-pre reaction and mix by flicking the tube.
Incubate Duration00:05:00 at TemperatureRoom temperature .
5m
Prepare fresh 80% ethanol for all the purifications to be done during the day.
Spin down the samples and pellet the beads on a magnet until the eluate is clear and colorless (Duration00:05:00 ). Keep the tubes on the magnet and pipette off the supernatant.
5m
Wash the beads with 200 µL of freshly prepared 80% ethanol without disturbing the pellet (incubate at least Duration00:00:30 ).
30s
Pipette off the ethanol using a pipette and discard.
Repeat the washing step: add 200 µL of freshly prepared 80% ethanol without disturbing the pellet (incubate at least Duration00:00:30 ), pipette off the ethanol using a pipette and discard.
30s
Briefly spin down and place the tubes back on the magnet for the beads to pellet. Pipette off any residual ethanol using P10. Allow to dry but do not dry the pellets to the point of cracking.
Remove the tubes from the magnetic rack and resuspend the pellet in 12 µL nuclease-free water.
Spin down and incubate for Duration00:02:00 at TemperatureRoom temperature .
2m
Pellet the beads on a magnet until the eluate is clear and colorless (Duration00:05:00 ).
5m
Transfer 10 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.
Quantify 1 µL of each eluted sample using a Qubit fluorometer.
Store amplicons at Temperature4 °C if used within 24 hours, or at Temperature-20 °C for long-term storage.

Comment: Keep the bead ratio during the clean-up at 1.8X or 1.5X to avoid losing small DNA fragments.
Library prep – Native barcode ligation
20m
Thaw the reagents at TemperatureRoom temperature :
  • Blunt/TA Ligase Master Mix: ensure the reagents are fully mixed by performing 10 full volume pipette mixes.
  • EDTA: mix by vortexing.
  • Native Barcodes (NB01-24): thaw the number of NB required for your number of samples at room temperature. Individually mix the barcodes by pipetting, spin down, and place them TemperatureOn ice .
Heating block set to Temperature25 °C .
Add the reagents in the following order per well, between each addition, pipette mix 10 - 20 times

AB
Reagent Quantity
End-prepped DNA 7.5 μL
Native Barcode (NB01-24) 2.5 μL
Blunt/TA Ligase Master Mix 10 µL

Thoroughly mix the reaction by gently pipetting and briefly spinning down.
Incubate for Duration00:20:00 at Temperature25 °C .
20m
Add 2 µL of EDTA (clear cap) or 4 µL of EDTA (blue cap) to each well and mix thoroughly by pipetting and spin down briefly.
Library prep – Pool, clean-up & quantification
33m 10s
Heating block set to Temperature37 °C .
Pool all the barcoded samples in a 1.5 mL Eppendorf DNA LoBind tube.
Resuspend the AMPure XP beads (AXP) by vortexing.
Add 1.5X of resuspended AMPure XP Beads (AXP) to the pool.
IncubateDuration00:10:00 at TemperatureRoom temperature .
10m
Spin down the samples and pellet the beads on a magnet until the eluate is clear and colorless (Duration00:05:00 ). Keep the tubes on the magnet and pipette off the supernatant.
5m
Wash the beads with 700 µL of freshly prepared 80% ethanol without disturbing the pellet (incubate at least Duration00:00:30 ).
30s
Pipette off the ethanol using a pipette and discard.
Repeat the washing step: add 700 µL of freshly prepared 80% ethanol without disturbing the pellet (incubate at least Duration00:00:30 ), pipette off the ethanol using a pipette and discard.
30s
Briefly spin down and place the tubes back on the magnet for the beads to pellet. Pipette off any residual ethanol using P10. Allow to dry but do not dry the pellets to the point of cracking.
Remove the tubes from the magnetic rack and resuspend the pellet in 37 µL nuclease-free water.
Incubate for Duration00:10:00 at Temperature37 °C . Every Duration00:02:00 , agitate the sample by gently flicking the sample for Duration00:00:10 to encourage elution.
12m 10s
DNA elution.
Pellet the beads on a magnet until the eluate is clear and colorless (Duration00:05:00 ).
5m
Transfer 35 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.
Quantify 1 µL of the library using a Qubit fluorometer.
Store amplicons at Temperature4 °C if used within 24 hours, or at Temperature-20 °C for long-term storage.
Library prep – Adapter ligation
20m
Thaw the reagents at TemperatureRoom temperature :
  • Native Adapter (NA): Spin down and place TemperatureOn ice .
  • NEBNext Quick Ligation Reaction Buffer (5X): may have a little precipitate. Allow the mixture to come to room temperature and pipette the buffer up and down several times to break up the precipitate, followed by vortexing the tube for several seconds to ensure the reagent is thoroughly mixed.
Add the reagents in the following order per sample
AB
Reagent Quantity
Pooled barcoded sample 30 μL
Native adapter (NA) 5 μL
NEBNext Quick Ligation Reaction Buffer 5X 10 µL
Quick T4 DNA Ligase 5 µL
Thoroughly mix the reaction by gently pipetting and briefly spinning down.
Incubate for Duration00:20:00 at TemperatureRoom temperature .
20m
Library prep – Clean-up & Quantification
40m
Thaw the reagents at TemperatureRoom temperature :
  • Elution Buffer (EB): Mix by vortexing, then spin down.
  • Short Fragment Buffer (SFB): Mix by vortexing, then spin down.
Resuspend the AMPure XP beads (AXP) by vortexing.
Add 75 µL (1.5X) of resuspended AMPure XP Beads (AXP) to the pool.
Incubate Duration00:10:00 at TemperatureRoom temperature .
10m
Spin down the samples and pellet the beads on a magnet until the eluate is clear and colorless (Duration00:05:00 ). Keep the tubes on the magnet and pipette off the supernatant.
5m
Wash the beads by adding 125 µL Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet (Duration00:05:00 ). Remove the supernatant using a pipette and discard.
5m
Repeat the previous step: add 125 µL Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet (Duration00:05:00 ). Remove the supernatant using a pipette and discard.
5m
Briefly spin down and place the tubes back on the magnet for the beads to pellet. Pipette off any residual supernatant using P10 (no need to wait here).
Remove the tubes from the magnetic rack and resuspend the pellet in 17 µL nuclease-free water.
Incubate for Duration00:10:00 at Temperature37 °C . Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage.
10m
DNA elution.
Pellet the beads on a magnet until the eluate is clear and colorless (Duration00:05:00 ).
5m
Transfer 15 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.
Quantify 1 µL of the library using a Qubit fluorometer.
Safe point: libraries in Eppendorf DNA LoBind tubes can be stored at Temperature4 °C for short-term storage or at Temperature-80 °C for single use and long-term storage of more than 3 months.
Library prep – Library dilution
Determine the molarity of the library using concentration (ng/µL) and the DNA amplicon average size (bp).
  • Use the formula: Molar concentration (fmol/µL) = [(concentration (ng/µL) / (Size * 660)) * 1.106]
  • or use the online tool: https://nebiocalculator.neb.com/#!/dsdnaamt.
In clean 0.2 mL thin-walled PCR tubes (or a clean 96-well plate), aliquot 45 fmol of library.
Make up to 12 µL using Elution Buffer (EB).
Library prep – Priming and loading the SpotON flow cell
5m
If not already done, check your flowcell before loading:
  • Open the MinKnow software.
  • From the menu, select the option allowing to check your flowcell.
Thaw the reagents at TemperatureRoom temperature : mix by vortexing, then spin down and store TemperatureOn ice
  • Sequencing Buffer (SB)
  • Library Beads (LIB)
  • Flow Cell Tether (FCT)
  • Flow Cell Flush (FCF)
Prepare the following flowcell priming mix as below, mix by vortexing, then spin down and store TemperatureOn ice :

AB
Reagent Quantity
Flow Cell Flush (FCF) 1170 μL
Flow Cell Tether (FCT) 30 μL
Thoroughly mix the contents of the Library Beads (LIB) by pipetting.
Prepare the following library mix and mix well by pipetting before use (beads must be resuspended):

AB
Reagent Quantity
Sequencing Buffer (SB) 37.5 μL
Library Beads (LIB) mixed immediately before use 25.5 μL
DNA library 12 µL
Open the MinION or GridION device lid and slide the flow cell under the clip. Press down firmly on the flow cell to ensure correct thermal and electrical contact.
Slide the flow cell priming port cover clockwise to open the priming port.
After opening the priming port, check for a small air bubble under the cover and, if present, draw back a small volume to remove any bubbles:
  • Set a P1000 pipette to 200 μL
  • Insert the tip into the priming port
  • Turn the wheel until the dial shows 220-230 μL, to draw back 20-30 μL, or until youcan see a small volume of buffer entering the pipette tip
  • Visually check that there is continuous buffer from the priming port across the sensorarray.
Load 800 µL of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait Duration00:05:00 .
5m
Complete the flow cell priming by gently lifting the SpotON sample port cover to make the SpotON sample port accessible.
  • Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
  • Load 200 μL of the priming mix into the flow cell priming port (not the SpotON sampleport), avoiding the introduction of air bubbles.
Load 200 µL of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air bubbles.
Mix the prepared library gently by pipetting up and down just prior to loading.
Add 75 µL of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.
Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port, and close the priming port.
Install the light shield on your flow cell as soon as library has been loaded for optimal sequencing output.
Close the device lid and set up a sequencing run on MinKNOW.
Sequencing - MINKNOW software
Open the MinKNOW software.
From the menu, select the option allowing to start the sequencing.
Fulfill the required information (flowcell Id, run name, kit name, barcoding, etc.).
Avoid enabling real-time basecalling, except when using a computer with sufficient performance to handle the process.
Start sequencing.
Protocol references
(1) Viarouge C, Breard E, Zientara S, Vitour D, Sailleau C. Duplex Real-Time RT-PCR Assays for the Detection and Typing of Epizootic Haemorrhagic Disease Virus. PLoS One. 2015 Jul 10;10(7):e0132540. doi: 10.1371/journal.pone.0132540. PMID: 26161784; PMCID: PMC4498883.

(2) Quan M, Lourens CW, MacLachlan NJ, Gardner IA, Guthrie AJ. Development and optimisation of a duplex real-time reverse transcription quantitative PCR assay targeting the VP7 and NS2 genes of African horse sickness virus. J Virol Methods. 2010 Jul;167(1):45-52. doi: 10.1016/j.jviromet.2010.03.009. Epub 2010 Mar 19. PMID: 20304015.

(3) Djikeng A, Halpin R, Kuzmickas R, DePasse J, Feldblyum J, Senganamalay N, Afonso C, Zhang X, Anderson NG, Ghedin E, Spiro DJ. Viral genome sequencing by random priming methods. BMC Genomics. 2008;9:5.

(4) Marcacci M, De Luca E, Zaccaria G, Di Tommaso M, Mangone I, Aste G, Savini G, Boari A, Lorusso A. Genome characterization of feline morbillivirus from Italy. J Virol Methods. 2016 Aug;234:146-153. doi: 10.1016/j.jviromet.2016.05.002. Epub 2016 May 4. PMID: 27155238; PMCID: PMC7172958.

(5) Sghaier S, Sailleau C, Marcacci M, Thabet S, Curini V, Ben Hassen T, Teodori L, Portanti O, Hammami S, Juriscic L, Spedicato M, Postic L, Gazani I, Ben Osman R, Zientara S, Bréard E, Calistri P, Richt JA, Holmes EC, Savini G, Di Giallonardo F, Lorusso A. Epizootic Haemorrhagic Disease Virus Serotype 8 in Tunisia, 2021. Viruses. 2022 Dec 21;15(1):16. doi: 10.3390/v15010016. PMID: 36680057; PMCID: PMC9866946.