Feb 28, 2025

Public workspaceOptimized Mung Bean Nuclease Nanoseq Library Preparation Protocol for Whole Genome Sequencing

DOI
https://dx.doi.org/10.17504/protocols.io.n2bvj97wwlk5/v1
  • Hsu Chao1,
  • Kavya Kottapalli1,
  • Qi Jiang1,
  • Muchun Niu2,
  • Chenghang Chuck Zong2,
  • Harsha Doddapaneni1
  • 1Human Genome Sequencing Center, Baylor College of Medicine;
  • 2Department of Molecular and Human Genetics, Baylor College of Medicine
hchao Chao
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.n2bvj97wwlk5/v1
Protocol Citation: Hsu Chao, Kavya Kottapalli, Qi Jiang, Muchun Niu, Chenghang Chuck Zong, Harsha Doddapaneni 2025. Optimized Mung Bean Nuclease Nanoseq Library Preparation Protocol for Whole Genome Sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvj97wwlk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 07, 2025
Last Modified: February 28, 2025
Protocol Integer ID: 123163
Keywords: Duplex Sequencing, NanoSeq, Mung bean nuclease (MBN) , optimized mung bean nuclease nanoseq library preparation protocol, whole genome sequencing duplex sequencing, hpych4v enzyme for genomic dna fragmentation, using dideoxy nucleotide, mechanical fragmentation of genomic dna, genomic dna fragmentation, stranded dna, genomic dna, more genome coverage, mung bean nuclease, sequencing accuracy, sequencing method, dideoxy nucleotide, sequencing protocol, sequencing, genome, parent dna strand, dna, hpych4v enzyme, combining botseq, nanoseq method, identifying true mutation, nanoseq
Funders Acknowledgements:
SMaHT Network (NIH)
Grant ID: 5UM1DA058229; UG3NS132132
Abstract
Duplex Sequencing (DS) is an ultra-accurate next-generation sequencing method that independently sequences both parent DNA strands, identifying true mutations shared between them and eliminating errors from artifacts or misincorporation. There are multiple duplex sequencing protocols, Nanoseq being one such method (PMID: 33911282). NanoSeq enhances duplex sequencing accuracy by combining BotSeqS (PMID: 27528664) with a restrictive end-repair method using dideoxy nucleotides, overcoming limitations of shallow sequencing and targeted panels for high-sensitivity applications. Here we describe step-by-step, the Nanoseq method using the mung bean nuclease, an enzyme that preferentially cleaves single-stranded DNA while preserving double-stranded DNA. Combining use of this enzyme following mechanical fragmentation of genomic DNA ensures nearly 2x more genome coverage compared to using the HpyCH4V enzyme for genomic DNA fragmentation. This method has been optimized and tested across >15 human tissues, including heart, muscle, colon, blood, cord blood, liver, and brain etc. to generate reproducible results.
Guidelines
Additional Notes

The accuracy of the qPCR-1 is critical quantification for optimizing the complexity of the sequencing library given the desired sequencing coverage, maximizing duplex coverage.

High adapter dimmer in step 7 library PCR could results in inefficient amplification.
Materials
Reagents
  • TE Buffer Thermo Fisher Scientific Catalog # 12090015
  • Mung Bean Nuclease New England Biolabs Catalog # M0250S
  • Mung bean nuclease buffer New England Biolabs Catalog # B0250S
  • UltraPure™ SDS Solution, 10% Thermo Fisher Scientific Catalog # 15553027
  • T4 Polynucleotide Kinase New England Biolabs Catalog # M0201S
  • NEBuffer™ 4 New England Biolabs Catalog # B7004S
  • Klenow Fragment (3'→5' exo-) New England Biolabs Catalog # M0212L
  • Dideoxynucleoside Triphosphate Set Millipore Sigma Catalog # 3732738001
  • dATP Solution (100mM) New England Biolabs Catalog # N0440S
  • T4 DNA Ligase New England Biolabs Catalog # M0202L
  • Adenosine 5'-Triphosphate (ATP, 10mM) New England Biolabs Catalog # P0756S
  • CS adapter (15 µM) Integrated DNA Technologies (IDT) Catalog # 1080799
  • xGen™ UDI 10nt Primer Plates 1-4 Integrated DNA Technologies (IDT) Catalog # 10008052
  • NEBNext® Ultra™ II Q5® Master Mix New England Biolabs Catalog # M0544L
  • AMPure XP Beckman Coulter Catalog # A63882
  • DEPC-Treated Water Thermo Fisher Scientific Catalog # AM9906
  • 10 mM Tris-HCl Elution buffer Invitrogen Catalog# A33566
  • DNA 7500 kit Agilent Technologies Catalog# 5067-1506
  • High Sensitivity DNA Kit Agilent Technologies Catalog# 5067-4626
  • KAPA Library Quant Complete kit (ABI Prism®) Roche Catalog # 07960204001
  • Nuclease free water, Thermo Fisher Scientific, Catalog# AM9937
  • 100 μM NanoqPCR primer 1: 5’-ACACTCTTTCCCTACACGAC-3’ IDT HPLC grade
  • 100 μM NanoqPCR primer 2: 5’-GTGACTGGAGTTCAGACGTG-3’ IDT HPLC grade
  • Ethanol absolute (200 Proof) Avantor Catalog # 89125-170

Equipments
  • Covaris E220 Focused-ultrasonicator system        Covaris, Catalog # 500239
  • QuantStudio‱ 6 Flex Real-Time PCR System, 384-well    Thermo Fisher Catalog # 4485691
  • PTC-200 Peltier Thermo Cycler   MJ Research Catalog # 8252-30-0001

Reagent1 x TE BufferThermo Fisher ScientificCatalog #12090015
ReagentMung Bean Nuclease - 1,500 unitsNew England BiolabsCatalog #M0250S
ReagentUltraPure™ SDS Solution, 10%Thermo FisherCatalog #15553027
ReagentT4 Polynucleotide Kinase - 500 unitsNew England BiolabsCatalog #M0201S
ReagentNEBuffer 4 - 5.0 mlNew England BiolabsCatalog #B7004S
ReagentKlenow Fragment (3'-5' exo-) - 1,000 unitsNew England BiolabsCatalog #M0212L
ReagentDideoxynucleoside Triphosphate SetMerck MilliporeSigma (Sigma-Aldrich)Catalog #03732738001
ReagentdATP Solution - 25 umolNew England BiolabsCatalog #N0440S
ReagentT4 DNA Ligase - 100,000 unitsNew England BiolabsCatalog #M0202L
ReagentAdenosine-5 Triphosphate (ATP) - 1 mlNew England BiolabsCatalog #P0756S
ReagentxGen™ NGS Adapters & Indexing Primers for Illumina® sequencingIntegrated DNA Technologies, Inc. (IDT)Catalog #1080799
ReagentxGen™ NGS Adapters & Indexing Primers for Illumina® sequencingIntegrated DNA Technologies, Inc. (IDT)Catalog #10008052
ReagentNEBNext Ultra II Q5 Master Mix - 250 rxnsNew England BiolabsCatalog #M0544L
ReagentAMPure XPBechman CoulterCatalog #A63882
ReagentDEPC-Treated WaterThermo FisherCatalog #AM9906
ReagentElution Buffer for Dynabeads™ mRNA Purification KitsThermo FisherCatalog #A33566
ReagentBioanalyzer DNA Analysis DNA 7500 KitAgilent TechnologiesCatalog #5067-1506
ReagentAgilent High Sensitivity DNA Kit Agilent TechnologiesCatalog #5067-4626
ReagentKAPA Library Quantification KitsRocheCatalog #07960204001
ReagentNuclease-Free Water (not DEPC-Treated)Thermo Fisher ScientificCatalog #AM9937
ReagentEthanol absolute, KOPTEC, meets analytical specification of BP, Ph. Eur., USP (200 Proof)Avantor SciencesCatalog #89125-176


Equipment
E220 Focused-ultrasonicator
NAME
Covaris
BRAND
500239
SKU
https://www.covaris.com/e220-focused-ultrasonicator-500239
LINK


Equipment
QuantStudio™ 6 Flex Real-Time PCR System, 384-well, laptop
NAME
Applied Biosystems™
BRAND
4485691
SKU
https://www.thermofisher.com/order/catalog/product/4485691
LINK

Equipment
PTC-200 Thermal Cycler
NAME
MJ Research
BRAND
8252-30-0001
SKU
https://www.gmi-inc.com/product/mj-research-ptc-200-thermal-cycler/?srsltid=AfmBOopNoU-2KhYScE8x1qQsrdebGEXKkaNSnnebjUbsH9pBJbJhxn0J
LINK



Troubleshooting
Library Preparation: DNA Shearing
5m
Prepare Amount50-100 ng DNA sample into Amount50 µL TE buffer in PCR plate.

Gently pipette up and down to mix.

Mix
Transfer entire sample volume into microTUBE plate (Covaris, 520078), spin plate at Centrifigation600 x g, 00:05:00 .

5m
Centrifigation
Shear DNA to about 450-bp on Covaris E220 Focused-ultrasonicator system (Covaris, Inc. Woburn, MA) with the following setting:
AB
Water level6
Power140
Duty cycle10%
Cycle Per Burst200
Treatment time40 seconds
Temperature7°C+/-2°C
Library Preparation: DNA sample purification
13m
Spin the microTUBE plate and transfer sheared DNA samples into PCR strip tube.
Centrifigation
Purify sheared DNA by adding Amount90 µL (1.8X) AMPure XP beads (Beckman Coulter Catalog # A63882) to tube and pipette up and down 8 times followed by Duration00:08:00 incubation at TemperatureRoom temperature .

8m
Incubation
Pipetting
Put sample tube on magnet stand for Duration00:05:00 .

5m
Remove and discard the supernatant.
Wash beads twice by adding Amount150 µL 80% ethanol.

Pipetting
Wash
Dry beads for 3-5 min at TemperatureRoom temperature .

Elute DNA into Amount22 µL DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906).

DNA QC on Bioanalyzer2100: optional
Optional
Dilute sheared DNA 10X using DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906).
Load Amount1 µL diluted DNA on Agilent HS DNA kit and QC on Bioanalyzer 2100.

Mung Bean Nuclease Treatment
45m
Dilute Mung Bean Nuclease to Amount0.25 µL .
AB
Mung Bean Nuclease (New England Biolabs Catalog # M0250S)1 µL
Mung bean nuclease buffer (New England Biolabs Catalog # B0250S)4 µL 
DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906)35 µL 
Mix well by pipetting up and down 10 times.
Mix
Prepare 0.3% SDS Solution.
AB
DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906)32 µL
UltraPure™ SDS Solution, 10% (Thermo Fisher Scientific Catalog # 15553027)1 µL
Mung bean nuclease reaction.

AB
Sheared DNA20 µL
Mung bean nuclease buffer (New England Biolabs Catalog # B0250S)2.8 µL
DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906)5.2 µL
diluted Mung bean nuclease (0.25 U/ µL)2.0 µL

Mix well by pipetting up and down 10 times.
Mix
Incubate reaction at Temperature30 °C Duration00:30:00 on thermocycler.

30m
Incubation
At the end of incubation, add Amount1 µL 0.3% SDS immediately and pipetting up and down to mix.

Pipetting
Mix
Sample Purification.
  • Add Amount60 µL (2X) AMPure XP beads (Beckman Coulter Catalog # A63882) to sample.
  • Pipetting up and down 8 times to mix.

Pipetting
Mix
Incubate at TemperatureRoom temperature for Duration00:10:00 , then put on magnet stand for Duration00:05:00 .

15m
Incubation
  • Wash beads with Amount150 µL with 80% Ethanol.
  • Dry beads at TemperatureRoom temperature for 3-5 min.


Elute DNA with Amount11.5 µL DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906).

Sample QC: Optional.
Optional
Dilute MBN treated DNA sample 10X and load Amount1 µL on High Sensitivity DNA Kit (Agilent Technologies Catalog# 5067-4626).

Pipetting
T4 PNK Treatment
30m
Prepare T4PNK reaction master mix:

AB
NEBuffer™ 4 (New England Biolabs Catalog # B7004S)1.5 µL
Adenosine 5'-Triphosphate (ATP) (New England Biolabs Catalog # P0756S)1.5 µL
T4 Polynucleotide Kinase (New England Biolabs Catalog # M0201S)1.0 µL
DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906)1.0 µL

T4PNK reaction
AB
MBN-treated DNA10 µL
T4PNK master mix5 µL

Gently pipetting up and down to mix.
Mix
Incubate at Temperature37 °C for Duration00:30:00 on a thermocycler.

30m
Incubation
A-Tailing
30m
Prepare Concentration1 millimolar (mM) equimolar dATP/ddBTPs.
AB
dATP Solution (New England Biolabs Catalog # N0440S)2.5 µL 
ddTTP Solution Dideoxynucleoside Triphosphate Set (Millipore Sigma Catalog # 3732738001)25 µL
ddCTP Solution Dideoxynucleoside Triphosphate Set (Millipore Sigma Catalog # 3732738001)25 µL
ddGTP Solution Dideoxynucleoside Triphosphate Set (Millipore Sigma Catalog # 3732738001)25 µL
DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906)172.5 µL 
Mix by gentle vortex.
Mix
Prepare A-Tailing reaction mix:
AB
NEBuffer™ 4 (New England Biolabs Catalog # B7004S)0.5 µL 
Klenow Fragment (3'→5' exo-) (New England Biolabs Catalog # M0212L)1.5 µL 
1 mM equimolar dATP/ddBTPs 1.5 µL 
DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906)1.5 µL 
Mix by gently pipetting up and down 6X.
Mix
A-Tailing reaction
AB
DNA sample from previous step.15 µL 
A-Tailing reaction mix5.0
Mix gently by pipetting up and down.
Mix
Incubate reaction at Temperature37 °C for Duration00:30:00 on a thermocycler.

30m
Incubation
Adapter Ligation
20m
Prepare Ligation master mix.
AB
NEBuffer™ 4 (New England Biolabs Catalog # B7004S)1.74 µL
Adenosine 5'-Triphosphate (10mM ATP) (New England Biolabs Catalog # P0756S)4.0 µL 
CS adapter (Integrated DNA Technologies (IDT) Catalog # 1080799)0.4 µL
DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906)9.76 µL
Mix gently by pipetting up and down 6 times.
Mix
Adapter ligation reaction
AB
DNA sample from A-Tailing step20 µL
Ligation master mix.15.9 µL
T4 DNA Ligase (New England Biolabs Catalog # M0202L)1.5 µL
Mix gently by pipetting up and down 6 times.
Mix
Incubate reaction at Temperature20 °C for Duration00:20:00 followed by Temperature4 °C hold on a thermocycler.

20m
Incubation
Purify sample with 1X (Amount37.4 µL ) AMPure XP beads (Beckman Coulter Catalog # A63882) and eluted into Amount25 µL H2O.
Optional: Dilute Amount1 µL adapter-ligated DNA 5X and load Amount1 µL library on High Sensitivity DNA Kit (Agilent Technologies Catalog# 5067-4626).
Note
If high adapter dimmer was seen on QC, perform a second AMPure XP beads purification.


Optional
Post Adapter-Ligation qPCR-1 Quantification
Prepare qPCR master mix.
AB
Primer Mix (KAPA Library Quant Kit, Roche Catalog # 07960204001)1 mL
KAPA SYBR qPCR Master Mix (KAPA Library Quant Kit, Roche Catalog # 07960204001)5 mL
100 μM Nanoseq PCR primer1: 5’-ACACTCTTTCCCTACACGAC-3’ (IDT, HPLC grade)20 µL
100 μM Nanoseq qPCR primer2: 5’-GTGACTGGAGTTCAGACGTG-3’ (IDT, HPLC grade)20 µL
Dilute adapter-ligated DNA 20x by adding Amount2 µL adapter-ligated DNA to Amount38 µL DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906).

Pipetting
qPCR reaction setup.
AB
20X diluted library1 µL
NFW Nuclease free water (Thermo Fisher Scientific, Catalog# AM9906)3 µL
qPCR master mix 6 µL
Mix by pipetting up and down 10X.
Mix
Set reactions as triplicates in 384 well plates.
qPCR Standards.
AB
Standard 1-6 (KAPA Library Quant Kit, Roche Catalog # 07960204001)2 μL
NFW Nuclease free water (Thermo Fisher Scientific, Catalog# AM9906)2 μL
qPCR master mix6 μL
PCR
Set reactions as triplicates in 384 well plates.
Mix by pipetting up and down 10X.
Mix
qPCR amplification.
Run qPCR reactions on QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems™) using the following PCR program:
ABCD
Step Temp Time Cycle #
1 95 °C 5 min 1
2 95°C 30 s 35
60°C 45 s
3 95°C 15 s 1
4 65°C 1 min 1
5 95°C 15 s 1
PCR
Determining the sample concentration.

The concentration (nM (fmol/μl)) is determined as follows:

mean of sample concentration × dilution factor (20)× 452/573/1,000.

Note
where 452 is the size of the standard in bp; 573 is the proxy for the average library size in bp.

Library PCR
Based on qPCR quantification result, dilute Concentration0.1 Mass Percent adapter-ligated DNA in Amount23.5 µL using DEPC-Treated Water (Thermo Fisher Scientific Catalog # AM9906).

Set up library amplification mix.
AB
adapter-ligated DNA (0.1 fmol)23.5 µL
IDT Index primer, xGen™ UDI 10nt Primers (IDT Catalog # 10008052)1.5 µL
NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs Catalog # M0544L)25 µL

Oligonucleotides sequences
P7 CAAGCAGAAGACGGCATACGAGAT[i7-NNNNNNNNNN]GTCTCGTGGGCTCGG
P5 AATGATACGGCGACCACCGAGATCTACAC[i5-NNNNNNNNNN]TCGTCGGCAGCGTC
Library amplification program.
ABCD
Step Temp Time Cycle #
1 98 °C 30 s 1
2 98°C 10 s 16*
65°C 75 s
3 65°C 5 min 1
4 4°C Hold 1
*The number of PCR cycles is dependent on the input: 0.1 fmol, 16 cycles; 0.3 fmol, 14 cycles; 0.6 fmol, 13 cycles; 5 fmol, 10 cycles.
Library Purification.
Purify amplified library twice with 0.75X AMPure XP beads (Beckman Coulter Catalog # A63882).
Elute library into Amount20 µL Concentration10 millimolar (mM) Tris-HCl Elution buffer (Invitrogen Catalog# A33566).

Library Quantification and normalization.
QC Amount1 µL library on DNA 7500 kit (Agilent Technologies Catalog# 5067-1506).

Dilute library to Concentration5 nanomolar (nM) in Concentration10 millimolar (mM) Tris-HCl Elution buffer (Invitrogen Catalog# A33566) for pooling.

Final Library Quantification by qPCR-2
Library dilution.
Dilute Concentration5 nanomolar (nM) library 3000X by sequential 100 X and 30X dilutions using Nuclease free water (Thermo Fisher Scientific, Catalog# AM9937).

Prepare qPCR-2 master mix.
AB
Primer Mix (KAPA Library Quant Kit, Roche Catalog # 07960204001)1 mL
KAPA SYBR qPCR Master Mix (KAPA Library Quant Kit, Roche Catalog # 07960204001)5 mL
PCR
qPCR-2 reaction setup.
AB
3000x diluted library or Standard 1-6 (KAPA Library Quant Kit) Roche Catalog # 079602040014 μL
qPCR master mix6 μL
PCR
Set reactions as triplicates in 384 well plates.
Mix by pipetting up and down 10X.
Pipetting
Mix
qPCR-2 amplification.
Carry out qPCR reactions on QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems™) using the following PCR program:
ABCD
Step Temp Time Cycle #
1 95 °C 5 min 1
2 95°C 30 s 35
60°C 45 s
3 95°C 15 s 1
4 65°C 1 min 1
5 95°C 15 s 1
PCR
Library Pooling
Pool libraries at equimolar concentrations based on qPCR-2 results and sequence libraries on Illumina platform for 30X coverage.
Protocol references

Federico Abascal, Luke M. R. Harvey, Emily Mitchell, Andrew R. J. Lawson, Stefanie V. Lensing, Peter Ellis, Andrew J. C. Russell, Raul E. Alcantara, Adrian Baez-Ortega, Yichen Wang, Eugene Jing Kwa, Henry Lee-Six, Alex Cagan, Tim H. H. Coorens, Michael Spencer Chapman, Sigurgeir Olafsson, Steven Leonard, David Jones, Heather E. Machado, Megan Davies, Nina F. Øbro, Krishnaa T. Mahubani, Kieren Allinson, Moritz Gerstung, Kourosh Saeb-Parsy, David G. Kent, Elisa Laurenti, Michael R. Stratton, Raheleh Rahbari, Peter J. Campbell, Robert J. Osborne & Iñigo Martincorena  Somatic mutation landscapes at single-molecule resolution Nature. 2021 May;593(7859):405-410, PMID: 33911282

Margaret L Hoang, Isaac Kinde, Cristian Tomasetti, K Wyatt McMahon, Thomas A Rosenquist, Arthur P Grollman, Kenneth W Kinzler, Bert Vogelstein, Nickolas Papadopoulos; Genome-wide quantification of rare somatic mutations in normal human tissues using massively parallel sequencing. Proc Natl Acad Sci USA. 2016 Aug 30;113(35):9846-51, PMID: 27528664