Feb 05, 2024

Optimising sample multiplexing oligos by flow cytometry

Optimising sample multiplexing oligos by flow cytometry
  • 1Walter and Eliza Hall Institute
Icon indicating open access to content
QR code linking to this content
Protocol CitationDaniel V Brown 2024. Optimising sample multiplexing oligos by flow cytometry. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbyjpovpk/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 14, 2023
Last Modified: February 05, 2024
Protocol  Integer ID: 81857
Keywords: scRNA-Seq, facs, sample multiplexing, hashtag, sample multiplexing oligos by flow cytometry optmisation, sample multiplexing oligos by scrna, sample multiplexing oligo, optimising sample multiplexing oligo, flow cytometry read, flow cytometry optmisation, fluorescent detection, out with fluorescent detection, labelled oligo, scrna, signal swapping
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Optmisation of sample multiplexing oligos by scRNA-Seq is costly and time consuming. A cheaper and faster method is to use a flow cytometry read-out with fluorescent detection oligonucleotides.
This method can also be used to mix samples with different fluorescently labelled oligos and investigate signal swapping.
Image Attribution
Made with Biorender.com
Guidelines
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Materials
  • Phosphate Buffered Saline, without magnesium and calcium
  • Sample multiplexing oligos (MULTI-Seq, CellPlex or Hashtag Antibody)
  • 10ug/mL DAPI
  • 30% BSA stock solution
  • Fluorescent detection oligonucleotides
ABC
NameSequenceModification
A647_FB2_detect/5Alex647N/CCTTAGCCGCTAATAGGTGAGC5' Alexa 647 modification
A594_FB2_detect/5Alex594N/TTGCTAGGACCGGCCTTAAAGC5' Alexa 594 modification
A594_FB1_detect/5Alex594N/TTGCTAGGACCGGCCTTAAAGC5' Alexa 594 modification
A647_Total-SeqC_detect/5Alex647N/CTGTCTCTTATACACATCTCCG5' Alexa 647 modification
AF647_oligo_dT_detect/5Alex647N/TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT5' Alexa 647 modification
Fluorescent detection oligonucleotides. Order with HPLC modification
MULTI-Seq barcoding oligos. I substituted the poly-A tail for 10x Genomics feature barcode 2 sequence.
ABC
NameSequenceBarcode
multiSeq_FB2_BC2CCTTGGCACCCGAGAATTCCACCACAATGGCTCACCTATTAGCGGCTAAGGCCACAATG
multiSeq_FB2_BC3CCTTGGCACCCGAGAATTCCATGAGACCTGCTCACCTATTAGCGGCTAAGGTGAGACCT
multiSeq_FB2_BC4CCTTGGCACCCGAGAATTCCAGCACACGCGCTCACCTATTAGCGGCTAAGGGCACACGC
multiSeq_FB2_BC5CCTTGGCACCCGAGAATTCCAAGAGAGAGGCTCACCTATTAGCGGCTAAGGAGAGAGAG
multiSeq_FB2_BC6CCTTGGCACCCGAGAATTCCATCACAGCAGCTCACCTATTAGCGGCTAAGGTCACAGCA
multiSeq_FB2_BC7CCTTGGCACCCGAGAATTCCAGAAAAGGGGCTCACCTATTAGCGGCTAAGGGAAAAGGG
multiSeq_FB2_BC8CCTTGGCACCCGAGAATTCCACGAGATTCGCTCACCTATTAGCGGCTAAGGCGAGATTC
multiSeq_FB2_BC9CCTTGGCACCCGAGAATTCCAGTAGCACTGCTCACCTATTAGCGGCTAAGGGTAGCACT
multiSeq_FB2_BC10CCTTGGCACCCGAGAATTCCACGACCAGCGCTCACCTATTAGCGGCTAAGGCGACCAGC
multiSeq_FB2_BC11CCTTGGCACCCGAGAATTCCATTAGCCAGGCTCACCTATTAGCGGCTAAGGTTAGCCAG
multiSeq_FB2_BC12CCTTGGCACCCGAGAATTCCAGGACCCCAGCTCACCTATTAGCGGCTAAGGGGACCCCA
multiSeq_FB2_BC13CCTTGGCACCCGAGAATTCCACCAACCGGGCTCACCTATTAGCGGCTAAGGCCAACCGG
Safety warnings
Please follow all Manufacturer safety warnings and recommendations.
Prepare multiplexing reagent
For CellPlex and Hashtag antibody the reagent comes ready to use.
Prepare a dilution series for titration if desired
MULTI-Seq oligo preparation
Mix anchor and barcode strands in 1:1 molar ratio in PBS (without FBS or BSA at 2 µM concentration (10X stock).
This is 6uL 50uM anchor LMO, and 15uL 10uM barcode oligo to 129uL plain PBS.
Make one unique barcode solution per sample.
Total 25 µL per sample.
Make a 10X solution of the Co-Anchor in PBS.
Add 3uL 50uM co-anchor to 141uL plain PBS.
Add 6uL 100uM fluorescent detection oligo. For example:
Alexa 647 feature barcode 2 detection oligo.
It is highly recomended to label in at least duplicate. On these occasions I label the other replicate with a Alexa 594 detection oligo and mix immediately before FACS analysis.
Sample preparation
I use suspension cell lines to titrate cell multiplexing oligos so the sample preparation is easy.
Prepare a single-cell suspension of the sample to be tested.
Wash cells once in plain PBS without additives. I centrifuge suspension cell lines at 400xg.
Resuspend in PBS.
Count cells and transfer 100k to 1M cells (preferably 500k) into a 1.5mL tube for labelling
Labelling samples with multiplexing oligos
This is largely based on original protocols but with the addition of a fluorescent secondary oligo.
Resuspend cells in 180uL of plain PBS.
Add 20 µL 10X Anchor:Barcode solution and pipette gently to mix 10 – 15 times.
Incubate on ice for 5 minutes.
Add 20 µL Co-Anchor solution and pipette gently to mix.
Incubate 5 minutes longer on ice.
Add 1.5mL of 1% BSA in PBS (ice cold) to quench.
Add 1.5mL of 1% BSA in PBS (ice cold) to quench.
Add 1mL of 1% BSA in PBS (ice cold) to quench.
Centrifuge cells at 4°C 400xg 5min.
Resuspend cells in the remaining 100uL of supernatant then transfer to a new 1.5mL tube.
Add 1.9mL 1% BSA in PBS and spin 5 minutes 400g at 4°C.
Repeat wash 2 more times for a total of 3 washes.
Resuspend cells in 500 µL of PBS + 1% BSA and transfer to 5mL polystyrene FACS tube
Flow cytometry
Use a FACS analyser to compare the signal of labelled samples to a control sample where only the fluorescent detection oligo has been added.
If you have replicate labelled samples with different fluorescent detection oligos, you may combine them at this step.
Add DAPI to a final concentration of 0.1ug/mL (1/100 stock tube).
Gate for debris, single cells and viable cells.
Aquire at least 10,000 viable cells per test.
Analyse with relevant software.
Protocol references
Marlon Stoeckius, Shiwei Zheng, Brian Houck-Loomis, Stephanie Hao, Bertrand Z Yeung,
William M Mauck, Peter Smibert, and Rahul Satija. Cell hashing with barcoded antibodies
enables multiplexing and doublet detection for single cell genomics. Genome biology, 19
(1):1–12, 2018.
Christopher S McGinnis, David M Patterson, Juliane Winkler, Daniel N Conrad, Marco Y
Hein, Vasudha Srivastava, Jennifer L Hu, Lyndsay M Murrow, Jonathan S Weissman, Zena
Werb, et al. Multi-seq: sample multiplexing for single-cell rna sequencing using lipid-tagged
indices. Nature methods, 16(7):619–626, 2019