Oct 29, 2025

Public workspaceOmni-ATAC

DOI
https://dx.doi.org/10.17504/protocols.io.j8nlky2pxg5r/v1
  • Dahlia Rohm1,2,
  • Joshua black1,2,
  • Sean R. McCutcheon1,2,
  • Alejandro Barrera1,2,
  • Shante Berry1,2,
  • Daniel Morone1,2,
  • Xander Nuttle3,4,
  • Celine de Esch3,4,
  • Derek Tai3,4,
  • Michael Talkowski3,4,
  • Nahid Iglesias1,2,
  • Charles Gersbach1,2
  • 1Duke University;
  • 2Center for Advanced Genomic Technologies;
  • 3Massachusetts General Hospital;
  • 4Broad Institute of Massachusetts Institute of Technology and Harvard University
  • Gersbach Lab
Andrea R Daniel
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.j8nlky2pxg5r/v1
Protocol Citation: Dahlia Rohm, Joshua black, Sean R. McCutcheon, Alejandro Barrera, Shante Berry, Daniel Morone, Xander Nuttle, Celine de Esch, Derek Tai, Michael Talkowski, Nahid Iglesias, Charles Gersbach 2025. Omni-ATAC. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlky2pxg5r/v1
Manuscript citation:
Activation of the imprinted Prader-Willi Syndrome locus by CRISPR-based epigenome editing.
Rohm D, Black JB, McCutcheon SR, Barrera A, Berry SS, Morone DJ, Nuttle X, de Esch CE, Tai DJC, Talkowski ME, Iglesias N, Gersbach CA. Cell Genomics. 2025 Feb 12;5(2):100770. doi: 10.1016/j.xgen.2025.100770. PMID: 39947136
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 13, 2025
Last Modified: October 29, 2025
Protocol Integer ID: 229701
Keywords: induced pluripotent stem cell, pluripotent stem cell, methods for atac, atac this protocol, atac
Funders Acknowledgements:
NIH
Grant ID: HG012053
Disclaimer
This protocol was adapted from the work of Dahlia Rohm and colleagues in the Gersbach lab at Duke University.
Abstract
This protocols describes methods for ATAC-seq in human induced pluripotent stem cells.
Troubleshooting
Cell Preparation
Harvest cells (no fixation), protocol to be defined by the user. Spin down cells at 500 ×g for 5 min, 4°C. Keep cells on ice for all steps. Ideally, do not process more than 6-8 samples at a time. Cells should be processed fresh.

Frozen cells were not used for this protocol, although frozen cells may be used.
Aspirate all supernatant, carefully avoiding cell pellet (may not be visible at this stage), using two      pipetting steps (aspirate down to 20-30ul with a p1000 pipette and remove final volume with a p10).
Add 50 μL of cold RSB (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2) containing 0.1% NP40, 0.1% Tween-20 and 0.01% Digitonin. Using wide bore tips gently pipette 3 times to suspend the cell pellet.
Incubate on ice for 3 minutes.
Wash out lysis with 1mL of cold RSB containing 0.1% Tween-20 and invert tube 3 times to mix
Spin down at 500 ×g for 10 min, 4°C. 
Aspirate all supernatant, carefully avoiding visible cell pellet, using two pipetting steps. Suspend nuclei pellet in 27ul 2X TD Buffer by pipetting up and down 5 times. Use 2ul to count nuclei. If nuclei are too concentrated to accurately count, dilute further with 2X TD Buffer. Adjust 50,000 nuclei to 25ul total using 2X TD Buffer. 
Transposition Reaction and Purification
Prior to transposition: make sure cells are viable.
For samples with more than 15-20% dead cells, discard or separate viable cells over Ficoll.
Make sure the cell pellet is set on ice. 
To make the transposition reaction mix, combine the following (prepare a master mix) then add 25ul to each sample:
2.5 μL Tn5 Transposase (#200341970)
16.5 μL 1X PBS
0.5 μL 10% Tween-20
0.5 μL 1% Digitonin (Invitrogen #BN2006)
5 μL Nuclease Free H2O
50 μl Total reaction volume
Gently pipette 3 times to mix nuclei suspension with the transposition reaction mix. 
Incubate the transposition reaction at 37°C for 30 min in a thermomixer with 1000 RPM mixing. 
Immediately following transposition, purify using a Zymo DNA Clean up Kit (#11-303C). 
Elute transposed DNA in 11 μL Elution Buffer (10mM Tris buffer, pH 8). 
Purified DNA can be stored at -20°C. 
PCR Amplification
To amplify transposed DNA fragments, combine the following in a PCR tube:
10 μL Transposed DNA (all)
2.5 μL 25μM Customized Nextera PCR Primer 1*
2.5 μL 25μM Customized Nextera PCR Primer 2*
1 μL KAPA HiFi polymerase (KK2101)
1.5 μL dNTPs (10mM stock)
10 μL 5x KAPA HF buffer
22.5 μL Nuclease free H2O
50 μL Total
*Complete list of primers available in Indexes section of this protocol
Cycle as follows for the pre-amplification reaction: 
            (1) 72°C, 5 min
            (2) 98°C, 30 sec
            (3) 98°C, 10 sec
            (4) 65°C, 30 sec
            (5) 72°C, 1 min
            (6) Repeat steps 3-5, 4x (5 cycles total)
            (7) Hold at 4°C 
Remove tubes from thermocycler and store on ice. Proceed to qPCR amplification to determine additional cycles immediately. To run a qPCR side reaction, combine the following: 
5 μL PCR pre-amplified DNA (10% of initial reaction)
5.26 μL Nuclease Free H2O
0.45 μL 25μM Customized Nextera PCR Primer 1
0.45 μL 25μM Customized Nextera PCR Primer 2 (Barcode)
0.09 μL 100x SYBR Green I* (Invitrogen Cat #S-7563)
0.45 μL dNTPs (10mM stock)
0.3 μL KAPA HiFi polymerase (KK2101)
 
15 μL Total
 
*10,000x SYBR Green I is diluted in 10mM Tris buffer, pH 8 to make a 100x working solution
qPCR cycle as follows: 
(1) 98°C, 30 sec
(2) 98°C, 10 sec
(3) 65°C, 30 sec
(4) 72°C, 1 min
(5) Repeat steps 2-4, 19x 
(6) Hold at 4°C 
After qPCR amplification, manually assess the amplification profiles and determine number of additional cycles to amplify. See Buenrostro et al 2015 (PMID: 25559105) for a detailed explanation. Basically, the additional number of cycles needed for the remaining 45 μL PCR reaction is determined as following: 
    (1) Plot linear Rn vs. Cycle
    (2) Calculate the # of cycle that corresponds to 1⁄4 of maximum fluorescent intensity 
Using the remaining 45 μL PCR reaction, run the required number of additional cycles. Most libraries will need 4-8 additional cycles. Anything needing more than 15 additional cycles should be considered as failed. Place the pre-amplified tubes back in the thermocycler without addition of any more reagents. Cycle as follows: 
(1) 98°C, 30 sec
(2) 98°C, 10 sec
(3) 65°C, 30 sec
(4) 72°C, 1 min
(5) Repeat steps 2-4, nk-1 times for nk cycles total (where nk is the number of additional cycles needed as determined in step 6 for sample k)
(6) Hold at 4°C 
Purify amplified library using 2X ratio of Ampure XP beads. Elute the purified library in 20 μL Elution Buffer (10mM Tris Buffer, pH 8). 
The workflow for the PCR purification process is as follows: 
1. Add 2 μL AMPure beads per 1.0 μL of sample (50μl for a 45μl PCR reaction). 
 2. Transfer to Eppendorf microcentrifuge tube and mix 10 times. Incubate 10min at RT to bind DNA fragments to paramagnetic beads. 
 3. Add magnet and wait until solution clears, about 5 min.
 4. Wash beads + DNA fragments twice with fresh 80% Ethanol to remove contaminants. With beads on magnet, add 200μl EtOH (or enough to cover the beads), leave 30 seconds, remove all EtOH. Repeat once. Air dry beads 2-3min at RT, no more than 5 min.
 5. Elute purified DNA fragments from beads. Remove magnet and suspend beads with 20 μl of 10mM Tris, pH 8. Mix10 times. Incubate 5 min then separate with magnet.
 6. Transfer to new tube.
Use Agilent TapeStation (or similar device) to run a D5000 tape and check quality of purified DNA fragments (nucleosomal banding pattern should be present). Identify the average fragment size for each sample. 
Use a Qubit dsDNA BR Assay Kit (Invitrogen cat no. Q32850, Q32853) and a Qubit Fluorometer to measure concentration of each sample.  
Use average fragment size and Qubit concentration to calculate the molarity of each sample. Make an equimolar pool of all samples for sequencing, and follow sample preparation and sequencing instructions for Illumina NextSeq 2000 or NovaSeq sequencing systems for 2x25bp paired-end reads. 
Indexes
A full list of Illumina adapters can be found at 
Illumina Adapter Sequences (1000000002694)
 
Nextera DNA indexes (page 16-17)
N701: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
 
N702: CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT
 
N703: CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT
 
N704: CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT
 
N705: CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT
 
N706: CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT
 
N707: CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGGAGATGT
 
N708: CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGGAGATGT
N501: AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTG
 
N502: AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTCAGATGTG
 
N503: AATGATACGGCGACCACCGAGATCTACACTATCCTCTTCGTCGGCAGCGTCAGATGTG
 
N504: AATGATACGGCGACCACCGAGATCTACACAGAGTAGATCGTCGGCAGCGTCAGATGTG
 
N505: AATGATACGGCGACCACCGAGATCTACACGTAAGGAGTCGTCGGCAGCGTCAGATGTG
 
N506: AATGATACGGCGACCACCGAGATCTACACACTGCATATCGTCGGCAGCGTCAGATGTG
 
N507: AATGATACGGCGACCACCGAGATCTACACAAGGAGTATCGTCGGCAGCGTCAGATGTG
 
N508: AATGATACGGCGACCACCGAGATCTACACCTAAGCCTTCGTCGGCAGCGTCAGATGTG
Protocol references
Protocol adapted from:
Corces MR, Trevino AE, Hamilton EG, Greenside PG, Sinnott-Armstrong NA, Vesuna S, Satpathy AT, Rubin AJ, Montine KS, Wu B, Kathiria A, Cho SW, Mumbach MR, Carter AC, Kasowski M, Orloff LA, Risca VI, Kundaje A, Khavari PA, Montine TJ, Greenleaf WJ, Chang HY. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods. 2017 Oct;14(10):959-962. doi: 10.1038/nmeth.4396. Epub 2017 Aug 28. PMID: 28846090; PMCID: PMC5623106.