Mar 19, 2026
Nucleotide-resolution mapping of regulatory elements via allelic readout of tiled base editing
- Basheer Becerra1,2,
- Sandra Wittibschlager3,
- Zain M. Patel2,
- Ana P. Kutschat3,
- Justin Delano2,
- Eric Che1,
- Anzhelika Tauber3,
- Ting Wu1,
- Marlena Starrs1,
- Christina S. Horstmann3,
- Sophie Müller3,
- Madelynn N. Whittaker2,
- Elise Sylvander4,
- Manfred Lehner4,
- Michael I. Love5,
- Benjamin P. Kleinstiver6,
- Martin Jankowiak7,
- Daniel E. Bauer1,
- Davide Seruggia3,
- Luca Pinello2
- 1Division of Hematology/Oncology, Boston Children’s Hospital, Department of Pediatrics, Harvard Medical School, Boston, USA;
- 2Molecular Pathology Unit and Center for Cancer Research, Massachusetts General Hospital Research Institute, Department of Pathology, Harvard Medical School, Boston, USA;
- 3St. Anna Children’s Cancer Research Institute (CCRI), CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria;
- 4St. Anna Children’s Cancer Research Institute (CCRI), Christian Doppler Laboratory for Next Generation CAR T Cells, Vienna, Austria;
- 5Department of Biostatistics, Department of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, NC, 27599, USA;
- 6Center for Genomic Medicine, Department of Pathology, Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA;
- 7Gene Regulation Observatory, Broad Institute of MIT and Harvard, Cambridge, MA, USA
External link: https://www.nature.com/articles/s41467-026-69918-8#citeas
Protocol Citation: Basheer Becerra, Sandra Wittibschlager, Zain M. Patel, Ana P. Kutschat, Justin Delano, Eric Che, Anzhelika Tauber, Ting Wu, Marlena Starrs, Christina S. Horstmann, Sophie Müller, Madelynn N. Whittaker, Elise Sylvander, Manfred Lehner, Michael I. Love, Benjamin P. Kleinstiver, Martin Jankowiak, Daniel E. Bauer, Davide Seruggia, Luca Pinello 2026. Nucleotide-resolution mapping of regulatory elements via allelic readout of tiled base editing. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l2d16qg1y/v1
Manuscript citation:
Becerra, B., Wittibschlager, S., Patel, Z.M. et al. Nucleotide-resolution mapping of regulatory elements via allelic readout of tiled base editing. Nat Commun (2026). https://doi.org/10.1038/s41467-026-69918-8
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 19, 2026
Last Modified: March 19, 2026
Protocol Integer ID: 313567
Keywords: sequencing of crispr, editing crispr, targeted sequencing, phenotype mapping at regulatory element, resolution mapping of regulatory element, crispr, editing mutagenesi, mutations in myb, phenotype mapping, transcription factor motif, resolution genotype, immunotherapy target in leukemia, mutation, rna, enhancer, immunotherapy target, regulatory sequence, editing myb
Funders Acknowledgements:
NHGRI
Grant ID: 1R35HG010717–01
NHGRI
Grant ID: UM1HG012010
Rappaport MGH Research Scholar Award
Grant ID: 2024-2029 (L.P.)
the Kayden-Lambert MGH Research Scholar Award
Grant ID: 2023-2028 (B.P.K.)
European Research Council (ERC) under the Horizon 2020 research and innovation program
Grant ID: No. 947803
the Austrian Science Fund
Grant ID: FWF 10.55776/P36302
Abstract
CRISPR tiling screens have enabled the characterization of regulatory sequences but are limited by low resolution arising from the indirect readout of editing via guide RNA sequencing and enrichment analysis. This study introduces an end-to-end experimental assay and computational pipeline, which leverages targeted sequencing of CRISPR-introduced alleles at the endogenous target locus following dense base-editing mutagenesis. As a proof of concept, we studied a putative CD19 enhancer, an immunotherapy target in leukemia, and identified alleles and single nucleotides crucial for CD19 regulation. Our visualization tools revealed transcription factor motifs corresponding to the top-ranked nucleotides. Validation experiments confirmed that mutations in MYB, PAX5, and EBF1 binding sites reduce CD19 expression. Critically, editing MYB and PAX5 motifs conferred resistance to CD19 CAR-T cell therapy, revealing how non-coding variants can drive immunotherapy escape. Taken together, this approach achieves nucleotide-resolution genotype-phenotype mapping at regulatory elements beyond conventional gRNA-based screens.
Attachments
Troubleshooting
Guide library preparation
Library cloning
i. Library structure below, with N being the 20 bp gRNA sequence GGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATA
ii. Reconstitute oligonucleotide pool to 100 µM
iii. Make a 1:100 dilution of the oligo pool to be used in the PCR
iv. Set up PCR to amplify gRNAs using the following primers:
F: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG
R: ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
Expected product:
TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT
Reaction: 25 µl
(8 reactions in parallel)
| Q5 2x Master mix | 12.5 µl | |
| F/R mix (10µM) | 2.5 µl | |
| H2O | 9 µl | |
| Oligo pool | 1 µl |
PCR conditions:
| A | B | C | D | E | F | G | |
| 98°C | 98°C | 55°C | 72°C | Back to B, 20 cycles total | 72°C | 12°C | |
| 30 s | 10 s | 20 s | 30 s | 5 min | endless |
v. Run PCR on a 2% agarose gel to check size (should be 140 bp)
vi. Digest pLKO5.sgRNA.EFS.GFP (Addgene #57822) overnight at 37°C:
Reaction: 50 µl
| Vector | 2.5 µg | |
| 10X Tango buffer | 5 µl | |
| 20 mM DTT | 2.5 µl | |
| Esp3I | 2 µl | |
| H2O | Up to 50 µl |
vii. Heat-inactivate the restriction enzyme at for 20 min at 65°C
viii. Run 5 µl of the digested vector on an agarose gel to confirm digestion
ix. Assemble GA reaction
Reaction: 10 µl
| PCR | 2 µl | |
| Digested vector | 1 µl | |
| GA 2x MasterMix | 5 µl | |
| H2O | 2 µl |
x. Incubate GA reaction in a thermocycler at 50°C for 15 min
xi. Purify using Monarch PCR & DNA Cleanup Kit. Resuspend in 20 µl water
Electroporation and plasmid isolation
i. Day 1
1. Remove electrocompetent E. Coli cells from the -80°C freezer and thaw on ice
2. Mix by tapping
3. Add 1 µl GA reaction to 25 µl E. coli, do 3 reactions in parallel (include a reaction with the digested vector only, as a negative control)
4. Pipet 25 µL of the cell/DNA mixture into an electroporation cuvette without introducing bubbles
5. Tap the cuvette on the table to deposit the cells across the bottom of the well
6. Electroporate using a 1.0 mm cuvette at 25 μF, 200 Ohms, 1500 volts using a BioRad electroporator
7. As soon as possible after the pulse, add 975 µL of SOC medium to the cuvette and pipet up and down three times to resuspend the cells
8. Transfer the cells and Recovery Medium to a culture tube already containing 1 mL of SOC medium
9. Shake culture tube containing a total of 2 mL of SOC medium at 250rpm for 1 h at 37°C
10. Pool the samples
11. Remove 1 µl and add to 500 µL of recovery media, mix well, and plate 125 µL (8,000X dilution) onto a pre-warmed 10 cm LB-Amp agar plate and then plate 375 µL (2,667X dilution) onto a separate LB-Amp agar plate: These dilution plates will be used to estimate transformation efficiency to ensure that full library representation is preserved. Also, do this for the GA of the digested vector.
12. Grow the plates inverted for 14 h at 37°C.
13. Divide the rest of the pooled sample in 3 Erlenmeyer flasks containing 100 ml LB-Amp each to grow Midiprep cultures overnight at 37°C while shaking
14. For the GA of the digested vector, plate the remaining undiluted culture in one LB-Amp agar plate
ii. Day 2
1. Isolate plasmid DNA from Midiprep cultures using Invitrogen‱PureLink‱ HiPure Plasmid Filter Midiprep Kit and pool the 3 reactions in the very end
2. Determine concentration using Nanodrop
3. For the dilution plates, count the number of colonies and multiple this number by the dilution factor for the total number of colonies on all plates (aim for >50X representation)
4. Also, select 10 colonies to grow Minipreps in 3 ml LB-Amp
iii. Day 3
1. Isolate plasmid DNA from Miniprep cultures using Monarch Plasmid Miniprep kit and elute in 50 µl
2. Send for Sanger sequencing (expect 10 unique guides)
3. Assess quality and completeness of library preps using NGS
Lentivirus production
Transfection
i. Seed HEK293T cells in 16 ml DMEM complete in 15cm dishes 24 h prior to transfection
ii. Transfect at 80% confluency with 8.75 μg of VSVG, 16.25 μg of psPAX2, and 25 μg of the lentiviral vector
iii. Mix the plasmids in a tube, then add 1 ml DMEM without additives and resuspend
iv. Add 150 μg of linear polyethylenimine (PEI) and mix the tube by inverting
v. Incubate for 15-20 min at room temperature
vi. Add to the cells dropwise
Harvesting and concentration
i. Change media to fresh DMEM complete 16–24 h post-transfection
ii. Collect first batch of lentiviral supernatant 48 h post-transfection, add 16 ml fresh DMEM complete
iii. Collect the second batch of lentiviral supernatant 72 h post transfection, pool with first batch
iv. Spin down for 5 min at 4000xg to pellet cells and debris
v. Transfer supernatant to fresh tube
vi. Transfer 27 ml of lentiviral supernatant to ultracentrifugation tube
vii. Add 5 ml of 20% sucrose slowly to the bottom of the tube
viii. Concentrate by ultracentrifugation at 24000 rpm for 2h at 4 ºC
ix. Discard supernatant and let the pellet dry for about 3 min
x. Resuspend pellet in 160 µl DMEM or DPBS and store 20 µl aliquots at -80°C until use
Titration
i. Seed 2.5 x 105 NALM6 ABE8e or NALM6 EvoCDA cells in 24 well plates in 500 µl RPMI complete per well
ii. Transduce with 0, 0.5, 1, 2, 4, 8 µL lentivirus in duplicates
iii. 3 days post transduction, change media to remove virus
iv. When confluent, add more media to expand cells
v. 7 days post transduction, assess percentage of GFP+ cells via flow cytometry
vi. Using linear regression, define lentivirus amount required to achieve 30% transduction efficiency (MOI = 0.3) for single viral integrations
Base editor screen in NALM6 cells
Base editor screen in NALM6 cells
Seed 3 replicates of 5–7.5x106 NALM6 ABE8e or NALM6 EvoCDA cells in 10-15 ml RPMI complete in T25 flasks and transduce with lentiviral library or sg218-only
3 days post transduction, change media to remove virus and expand cells to 15-20 ml in T25 flasks
Day 5: Add more media
7 days post transduction, collect all cells and count
Process 20-50x106 cells for FACS sorting
Wash once in 3 ml DPBS
Strain through a 35 µm nylon mesh and resuspend in 1 ml DPBS/10x106 cells for sorting
After sorting, collect cells in DPBS and store on ice
Collect cells at 2000xg for 5 min
Resuspend in 200 µl DPBS and store at -20°C
Isolate DNA with Qiagen DNeasy Blood & Tissue Kit and elute in 20-50 µl
Quantify with Nanodrop
Library prep for sequencing
Prepare gRNA-based libraries by amplifying the gRNA-containing region, prepare allele-based libraries by amplifying the endogenous enhancer region
For gRNA-based libraries
i. Perform PCR1 to attach overhangs
Primers:
F: AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG
R: CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCCC
Reaction: 25 µl (8 reactions per sample)
| Q5 2x Master mix | 12.5 µl | |
| F/R mix (10µM) | 2 µl | |
| DNA | 5-20 ng | |
| H2O | Up to 25 µl |
PCR conditions:
| A | B | C | D | E | F | G | |
| 98°C | 98°C | 56°C | 72°C | Back to B, 25 cycles total | 72°C | 12°C | |
| 30 s | 10 s | 30 s | 30 s | 5 min | endless |
ii. Perform PCR 2 to attach Illumina adapters and barcodes
Primers:
We use dual barcodes. In addition, the forward oligo carrys a stagger of variable length to increase library complexity. Use a unique combination of forward and reverse primer for each sample to differentiate them after sequencing (see Supplementary Table 1 of publication).
Reaction: 25 µl (8 reactions per sample)
| Q5 2x Master mix | 12.5 µl | |
| F/R mix (10µM) | 2 µl | |
| PCR 1 | 2 µl | |
| H2O | 8.5 µl |
PCR conditions:
| A | B | C | D | E | F | G | |
| 98°C | 98°C | 60°C | 72°C | Back to B, 25 cycles total | 72°C | 12°C | |
| 30 s | 10 s | 30 s | 30 s | 5 min | endless |
For allele-based libraries
i. Perform PCR1 to attach overhangs
Primers:
F: CTACACGACGCTCTTCCGATCTACATGCTCTAGTGAAAGCCAGT
R: AGACGTGTGCTCTTCCGATCTGCACTCTCTATGTGCCTCTGTGT
Reaction: 25 µl (8 reactions per sample)
| Q5 2x Master mix | 12.5 µl | |
| F/R mix (10µM) | 2 µl | |
| DNA | 5-20 ng | |
| H2O | Up to 25 µl |
PCR conditions:
| A | B | C | D | E | F | G | |
| 98°C | 98°C | 60°C | 72°C | Back to B, 20 cycles total | 72°C | 12°C | |
| 30 s | 10 s | 30 s | 30 s | 2 min | endless |
ii. Perform PCR2 to attach Illumina adapters and barcodes
Primers: We use dual barcodes. Use a unique combination of forward and reverse primer for each sample to differentiate them after sequencing (see Supplementary Table 1 of publication).
Reaction: 25µl (8 reactions per sample)
| Q5 2x Master mix | 12.5 µl | |
| F/R mix (10µM) | 2 µl | |
| PCR 1 | 5 µl | |
| H2O | 5.5 µl |
PCR conditions:
| A | B | C | D | E | F | G | |
| 98°C | 98°C | 60°C | 72°C | Back to B, 20 cycles total | 72°C | 12°C | |
| 30 s | 10 s | 30 s | 30 s | 2 min | endless |
Pool all PCR2 reactions for each sample
Mix 75 µl PCR product with 15 µl of 6x loading dye for gel extractions
Load 2 adjacent pockets with 45 µl each on a 2% agarose gel and run for 45 min (leave 1 empty pocket between each sample to simplify cutting of the gel)
Perform gel extraction of 350 bp band using GeneJET Gel Extraction Kit, elute in 50 µl
Quantify libraries using Qubit
Pool libraries and run on Tapestation for a quality check
Perfom Illumina paired-end sequencing and demultiplex based on P7 and P5 indices