Sep 09, 2024

Nematode DNA Illumina Amplicon Sequencing using two step PCR

This  protocol  is a draft, published without a DOI.
Nematode DNA Illumina Amplicon Sequencing using two step PCR
  • 1UK Centre for Ecology & Hydrology;
  • 2UKCEH;
  • 3Department for Food, Environment & Rural Affairs
Icon indicating open access to content
QR code linking to this content
Protocol CitationLindsay Newbold, Joe Taylor, Vilma Cortes 2024. Nematode DNA Illumina Amplicon Sequencing using two step PCR. protocols.io https://dx.doi.org/
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 05, 2024
Last Modified: September 09, 2024
Protocol  Integer ID: 106983
Keywords: Biofilms, Metabarcoding, DNA, Microbiology, nematode dna illumina amplicon sequencing, amplicon sequence data on the miseq illumina, analyzing amplicon sequence data, sequencing platform, sequencing, sequencing strategy, appl environ microbiol, nematode, illumina miseq platform, metabarcoding of dna, step pcr this document, step pcr, step amplicon, curation pipeline, primer
Funders Acknowledgements:
Defra
Grant ID: 09135 CWI-MLS-DEFRA NCEA 115 NE Nematode Barcoding
Natural England
Abstract
This document is designed to provide the researcher with all of the information required to undertake the metabarcoding of DNA from Nematodes which have already been physically separated from soil. Here we outline our methodology for two step amplicon sequencing using the Illumina MiSeq platform.

The aim is to provide a framework upon which the researcher may choose to add their own modifications to suit novel applications.

Much of the protocol has been adapted for use from the methodology outlined in :

Kozich JJ, Westcott SL, Baxter NT, Highlander SK, Schloss PD. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl Environ Microbiol. 2013 Sep;79(17):5112-20. doi: 10.1128/AEM.01043-13. Epub 2013 Jun 21. PMID: 23793624; PMCID: PMC3753973.

Primers selected are based upon those referenced in the text and in reference section.

All kits and equipment are given as recommendations based upon resources available to UKCEH laboratories and are not intended to be discriminatory against alternatives or emerging methodologies. However, we would recommend researchers perform their own validation of any changes.
Nextera index plates- Prepared prior to Step 1 PCR
Order indexing primers direct from oligo manufacturer (For example IDT, Sigma genosys or MWG) suspended in water 0.5 µM scale, Desalt purification and10 µM concentration. These indexing primers consist of: an Illumina Nextra adapter i5 (Forward primer) AATGATACGGCGACCACCGAGATCTACAC or i7 (reverse primer) CAAGCAGAAGACGGCATACGAGAT, Unique 8bp barcode sequence and pre-adapter i5 TCGTCGGCAGCGTC (F) or i7 GTCTCGTGGGCTCGG (R). Barcode design when demultiplexed allows for the unique assignment of an individual sequence to sample. Figure 1 gives a graphical representation of how 16 Forward, and 24 Reverse barcodes sequences are allocated to give 384, unique barcode combinations. Full barcode sequence including an additional 384 barcode combinations (named arrays A-H) is given in attached document.
Figure 1: An illustration of Dual-index primer pair allocation
Download Array Plate description.xlsxArray Plate description.xlsx



Prepare index plate ‘masters’ mannually allocating 250 µL of each diluted primer stock 10 micromolar (µM) per well as per plate design detailed above into Deep-Well microtiter plates. Alternatively this can be done using a liquid handling Robot.

Make PCR plate clones of the ‘master’ plates, each well containing 5ul of mixed primer, label, seal and store at -20 for future use.
Step I- Amplicon PCR with modified primers
Make a standardised dilution plate of template DNA from DNA extraction process. DNA concentration is determined through Qubit BR or HS assay of raw extract, and then each extract is diluted to a standardised concentration (this is subject to extraction success, but shouldn't be below 2ng/ul to allow for effcient PCR), using the equation:

Desired Concentration (ng/ul)
________________________________________ X Final desired volume = Amount of DNA to add
Raw extract Concentration (ng/ul)

To work out the amount of water its : Final desired volume - Amount of DNA to add

If DNA extract concentration is below 2ng/ul we would recommend that DNA is either concentrated or if feasible 2ul of template DNA used in subsequent PCR steps.

Step 1 Amplicon primers consist of a pre adapter, sequencing primer and specific locus primer. Target primers are designed as per Table 1:

ABCDEFGH
Source referenceUniversal primer nameTarget 18S Hypervariable regionpre-adapterSequencing primer sequence Specific locus primerCombined sequencePrimer pair group
Mangot et al (2012) https://doi.org/10.1111/1462-2920.12065NSF563V4TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGCGGTAATTCCAGCTCCATCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGCGGTAATTCCAGCTCCAF
Mangot et al (2012) https://doi.org/10.1111/1462-2920.12065NSR951V4GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTGGYRAATGCTTTCGCGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTGGYRAATGCTTTCGCF
Blaxter et al (1998) https://www.nature.com/articles/32160SU18AV1-V3TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAAGATTAAGCCATGCATGTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAAGATTAAGCCATGCATGA
Blaxter et al (1998) https://www.nature.com/articles/32160SSU9RV1-V3GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGCTGGAATTACCGCGGCTGGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGCTGGAATTACCGCGGCTGA
Kawanobe et al (2021) https://doi.org/10.1016/j.apsoil.2021.103974F548_AV4TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGAGGGCAAGTCTGGTGCCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGAGGGCAAGTCTGGTGCCC
Hadziavdic et al (2014) https://doi.org/10.1371/journal.pone.0087624R915V4GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCAAGAATTTCACCTCGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCAAGAATTTCACCTCC
Porazinska et al (2009) https://onlinelibrary.wiley.com/doi/10.1111/j.1755-0998.2009.02611.xNF1V7-V8TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GGTGGTGCATGGCCGTTCTTAGTTTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GGTGGTGCATGGCCGTTCTTAGTTE
Porazinska et al (2009) https://onlinelibrary.wiley.com/doi/10.1111/j.1755-0998.2009.02611.x18Sr2bV7-V8GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACAAAGGGCAGGGACGTAATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACAAAGGGCAGGGACGTAATE
Table 1: Step I amplicon primers employed during for the amplification of Nematode communities


Using column ‘Combined sequence’ given in Table 1, order primers direct from oligo manufacturer (For example IDT, Sigma genosys or MWG) suspended in water 0.5 µM scale, Desalt purification and100 µM concentration.
Choice of primer set and region should be selected based upon project requirements - see Defra report for project CN115 (Taylor, Newbold and Cortez, 2024)- as differing hypervariable regions may influence sequence community composition results.
ABC
ReagentPer SamplePer 100
Molecular Grade Water27.3 ul2730 ul
5 X Buffer10 ul100 ul
High GC Buffer10 ul100 ul
10 mM dNTP's1 ul100 ul
Q5 Taq Polymerase0.5 ul50 ul
Primer F (100mM)0.1 ul10 ul
Primer R (100mM)0.1 ul10 ul
DNA Template (at ~5 ng/ml)1 ulAdded separately
Table 2: 1 Step PCR Reagents in the order in which they should be added. Note that Template is added separately after PCR Mastermix plate has been prepared.
All reagents from above Table 2 (except template DNA) are added to a 5ml Tube (or equivalent) to form a PCR Mastermix.
Mastermix is prepared on ice, using filter tips and under sterile conditions in the PCR hood.

Once Mastermix has been made add 49 µL of Mastermix to each well of a 96 well PCR plate using a multichannel pipette (accurate for volumes between 100 µL - 300 µL ).

We recommend the use of :

Axygen™ 96-Well Low Profile PCR Microplates (SKU AXY-PCR-96-LP-FLT-C)

and
Equipment
Research Plus Multichannel pipette
NAME
Multichannel Pipette
TYPE
Eppendorf
BRAND
3125000052
SKU
LINK

Add 1 µL of standard dilution from step 4 to respective position in the mastermix plate. This ensures full traceability when samples are demultiplexed during the bioinformatics steps performed post sequencing. It is therefore imperative that experimenters make a note of which sample is added to each well of the PCR mastermix plate.


Seal plates with PCR film, and centrifuge, to concentrate sample.

We recommend the use of:


Initiate PCR reaction on Thermal cycler
We recommend the BIORAD C1000 touch thermal cyler https://www.bio-rad.com/en-uk/product/c1000-touch-thermal-cycler?ID=LGTW9415

PCR program:
  • Pre-denature 95 °C for 10:00m
  • Denature 95 °C 00:20s
  • Anneal 52 °C (SU18A-SSU9R), 62°C (F548_A-R915), 51°C(NF1-18Sr2b) and 55°C (NSF563-NSR941) for 00:30s
  • Extension 72 °C for 00:30s
  • Repeat ii. – iv. 35 cycles
  • Final extension 72 °C for 10:00m



Gel Electrophoresis
Verify PCR products using gel electrophoresis.
Prepare the appropriate electrophoresis tank and casting tray. The number and type of gels required will depend on the number of samples.
A Mini-sub Cell GT Horizontal Electrophoresis Tank. Can run up to 28 samples + two ladder lanes. The 7 x 10 cm casting tray requires 50 ml agarose mix.
A Wide Mini-sub Cell GT Horizontal Electrophoresis Tank (Midi Tank). Can run up to 58 samples + two ladder lanes. The 15 x 10cm casting tray requires 100ml agarose mix.
Sub-Cell 96 GT Horizontal Electrophoresis Tank. Can run up to 100 samples + two ladder lanes. The 25 x 15 cm casting tray requires 250ml agarose mix.
To make a 1 % (v/v) agarose gel : For a Midi Gel, measure 1g of molecular grade agarose powder into a glass pyrex beaker and make up to 100 mL using 1 X TBE buffer. Heat in microwave to dissolve for approx 00:02:00 . When no agarose crystals are visable, cool the gel in a sink filled with a little water, to just above room temperature,. Cooling in this way will take atleast 00:02:00 . As a rule of thumb if you're able to hold the base of the beaker without discomfort the gel is ready.

4m
To a 100ml mix add 1 μl ethidium bromide, or 5 μl Gel Red
Swirl to mix and pour into gel casting tray set up as below.


Biorad gel caster. To use push two casting walls together and tighten using lever.
Place combs directly into the casting tray (in above tray line up comb ends with 2nd notch and push down). If bubbles are present these can be pushed out of gel using combs before final positioning and tightening lever.

Leave gel to set for at least 00:45:00 .

45m
Whilst gel is setting, prepare samples using 5 µL PCR amplicon to 1 µL Bromophenol blue gel loading buffer.

When set load loosen casting lever and place tray and gel into Gel tank filled with 1X TBE buffer to fill line. Remove combs (doing this in the buffer prevents bubbles forming in wells). Add 5 µL Hyper ladder 1KB https://www.bioline.com/hyperladder-1kb.html (or similar) to first well of agarose gel by placing tip into well and gently depressing pipette control, whilst slowly removing tip from well. Repeat proceedure with samples, each being placed in its an individual well.
When all samples are loaded put on gel tank lid, and plug in cables (red to red, black to black). Set gel to run for 00:45:00 at 90 Volts.
45m

A successful PCR should look similar to below.

Figure 4: Result of ITS2 PCR.

PCR Clean-up

Clean-up Amplicon PCR step I using ZymoZR-96 kit (standard Manufacturers protocol), again using filter tips and upmost care throughout as samples are not indexed.

Alternatively use Multiscreen-PCR96 Filter plate under standard manufacturers protocol if liquid handling robot and vacuum manifold are available.

Step II - Nextera indexing PCR
Use 1-10 µL Cleaned PCR product as template for Step II- Indexing PCR (Table 3). Template input should be driven by PCR concentrations observed in during step 11. Water added to PCR master mix is adjusted to make each reaction total 25 µL .

ABC
ABC
ReagentPer SamplePer Plate
Molecular Grade Water7.25 ul725 ul
5 X Buffer5 ul500 ul
High GC Buffer5 ul500 ul
10 mM dNTP's0.5 ul50 ul
Q5 Taq Polymerase0.25 ul25 ul
Primer Array mix5 ulAdded separately
PCR Template 2 ulAdded separately
Table 3: Step II PCR Reagents in the order in which they should be added. Note that Template and primer mix are added separately after PCR Mastermix plate has been prepared.
PCR programme :
  • Denature 95 °C for 02:00m
  • Denature 95 °C for 00:15s
  • Anneal 55 °C for 00:30s
  • Extension 72 °C for 00:30s
  • Repeat to total 10 cycles
Normalisation
45m

Resultant PCR products are normalised using the Norgen NGS Normalization 96-Well Kit – 61900 under standard manufacturers protocol:
UK distributers
Use ~ 5 µL normalised PCR product from each sample to form a pooled library.
Vacuum concentrate to a volume of approx 30 µL pooled normalised plate library.
We reccomend:
Whilst Vacuum concentration is occuring prepare a 50ml 1% Agarose gel, with a wide comb.
Add 5 µL loading buffer to concentrate and run for 00:45:00 at 90 Volts.
45m
Excise resultant band using sterile scapel, and visualised on blue light Led trans illuminator

Extract DNA from agarose Gel using QIAquick Gel Extraction Kit - QIAGEN under manufactuers standard protocol. Samples eluted in 30 µL buffer EB.
Quantification
Gel Purified libraries are quantified using Invitrogen™ Qubit™ 1X dsDNA High Sensitivity (HS) quantification kit
Under manufacturers protocol and companion qubit fluorometer

Calculate Molar concentration using the https://www.bioline.com/media/calculator/01_07.html

AB
Amplicon Amplicon bp (inc illumina adapters)
SU18A-SSU9R624
F548_A-R915452
NF1-18Sr2b447
NSF563-NSR941533
Note: The above lengths are calculated by using mean amplicon specific primer fragment length (determined through in silico analysis), plus additional illumina specific tags. This is important as library run concentration is based upon molarity.


If using multiple libraries mix equal concentrations of each arrays: e.g. Array plate A library + Array plate B library.

Your library is now ready for sequencing!
Sequencing on V2 or V3 Miseq
7m
Please note that much of the following is an ammended version of the Schloss lab SOP, therefore their work should always be referenced.

Remove a V3 600 cycle/V2 500 cycle reagent cartridge from the-20 °C freezer. Place in room temperature water bath for one hour. Place Hyb buffer tube in4 °C fridge. While reagent cartridge is thawing, perform steps 23-27.

Prepare fresh 0.1 Mass Percent NaOH.

To a 1.5 mL tube, add 10 µL of library and 10 µL of 0.1 Mass Percent NaOH. To a separate tube add 2 µL PhiX, 3 µL PCR grade water, and 5 µL of 0.1 Mass Percent NaOH. Pipette to mix. Note: NaOH concentration on the flow cell must remain under 0.001M.

Allow the tubes to incubate at room temperature for 00:05:00 . Immediately add 980 µL of ice-cold Hybridisation buffer (Hyb) to the library tube, and 990 µL Hyb to the PhiX tube.

Note: the resulting 20pM PhiX can be frozen and used for subsequent runs.

5m
Use HTI to further dilute both the library and PhiX to 7.5 pM.
See example below:
a. (1.78 nM library x 10 ul) + (0.1N NaOH x 10 ul) + 980 ul HTI = 17.8 pM Lib, 0.001N NaOH
b. 17.8pM lib/7.5 =2.3733333333
c. 1000/2.373333333 =421.35ul (Denatured Library to add to 578.65 HTI Buffer)

d. 20pM PhiX /7.5 =2.666666
e. 1000/2.66666 = 375ul (Denatured Library to add to 625 HTI Buffer)
For a 10% PhiX run, combine900 µL of 7.5 picomolar (pM) Library and 100 µL 7.5 pM PhiX in a final tube.
Vortex. At this final stage heat to 96 °C for 00:02:00 . Then cool immediately on ice.

2m
When the reagent cartridge has thawed, dry bottom with paper towel. Invert the cartridge repeatedly to check each well is thawed. This also serves to mix the reagents. Place in Fridge
Load 600 ul of the final Libary/PhiX solution into well 17 on the reagent cartridge.
Unbox flow cell and PR2 bottle.Thoroughly rinse the flow cell with Milli-Q water. Carefully dry by blotting with lint free wipes (Kimwipes). Give special attention to the edges and points of intersection between the glass and plastic. Wet a new wipe with 100% alcohol and wipe the glass on both sides avoiding the rubber intake ports.Visually inspect the flow cell to ensure there are no blemishes, particles, or fibers on the glass. Follow on screen instructions to load the flow cell, reagent cartridge, and PR2 bottle. Empty and replace the waste bottle.
Transfer reagent cartridge, flow cell, PR2 bottle, and flash drive with the sample sheet to the MiSeq. Open Sample Sheet from the flash drive in the MiSeq Local run manager software and queue run. Ensure the machine recognizes the correct sample sheet and the run parameters are correct.
Wait for the MiSeq to perform its pre-run checks, and press start. NOTE: If the pre-run check fails, try wiping down the flow cell again.
Ideal parameters for a 90% run:
a. Cluster density 1000-1200k/mm2 for V2 kits 1200-1400k/mm2 for V3 kits,
b. >85% clusters passing filter
c. 10% aligned (amount of PhiX)
d. No spikes in corrected intensity plot
e. All indices identified following index reads
f. Final >Q30 score of >70%
When run complete, perform post run wash as per manufacturers recommendations.
Protocol references
Kozich JJ, Westcott SL, Baxter NT, Highlander SK, Schloss PD. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl Environ Microbiol. 2013 Sep;79(17):5112-20. doi: 10.1128/AEM.01043-13. Epub 2013 Jun 21. PMID: 23793624; PMCID: PMC3753973.
Walters W, Hyde ER, Berg-Lyons D, Ackermann G, Humphrey G, Parada A, Gilbert JA, Jansson JK, Caporaso JG, Fuhrman JA, Apprill A, Knight R. 2016. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys. mSystems 1:10.1128/msystems.00009-15.
Mangot JF, Domaizon I, Taib N, Marouni N, Duffaud E, Bronner G, Debroas D. 2013. Short-term dynamics of diversity patterns: evidence of continual reassembly within lacustrine small eukaryotes. Environ Microbiol 15:1745-58.
Kawanobe M., Toyota K. and Ritz, K., 2021. Development and application of a DNA metabarcoding method for comprehensive analysis of soil nematode communities. Applied Soil Ecology, 166, p.103974.
Hadziavdic K., Lekang K., Lanzen A., Jonassen I., Thompson E.M., et al. (2014) Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers. PLOS ONE 9(2): e87624.
Porazinska, D.L., Giblin‐Davis, R.M., Faller, L., Farmerie, W., Kanzaki, N., Morris, K., Powers, T.O., Tucker, A.E., Sung, W.A.Y. and Thomas, W.K., 2009. Evaluating high‐throughput sequencing as a method for metagenomic analysis of nematode diversity. Molecular Ecology Resources, 9(6), pp.1439-1450.