Nov 07, 2023

NEBNext Ultra II Library Prep for Illumina Low Volume Version (Naturalis)

This protocol is a draft, published without a DOI.
  • 1N/A
Icon indicating open access to content
QR code linking to this content
Protocol CitationStacey Dubbeldam 2023. NEBNext Ultra II Library Prep for Illumina Low Volume Version (Naturalis). protocols.io https://dx.doi.org/
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: November 06, 2023
Last Modified: November 07, 2023
Protocol  Integer ID: 90449
Keywords: ultra ii dna library protocol, illumina low volume version, ultra ii library prep, dna, illumina, naturali, low volume version, library
Abstract
Low volume version of NEBNext Ultra II DNA library protocol (Naturalis).
Protocol materials
TE Buffer
NEBNext Ligation Master MixNew England BiolabsCatalog #E7648AAVIAL
NEBNext® Ligation EnhancerNew England BiolabsCatalog #E7374AAVIAL
NEBNext Adaptor for IlluminaNew England BiolabsCatalog #E7337 in Kits E7335, E7500, E771
NEB USER® EnzymeNew England BiolabsCatalog #M5505S/L
NEBNext Ultra II Q5 Master Mix - 250 rxnsNew England BiolabsCatalog #M0544L
NEBNext Ultra II End Prep Enzyme MixNew England BiolabsCatalog #E7646
NEBNext dA-Tailing Reaction Buffer - 2.0 mlNew England BiolabsCatalog #B6059S
NEBNext Ultra II Library Prep for Illumina Low Volume Version (Naturalis)
Make sure that the DNA is eluted in TE Buffer . If this is not the case, samples can be diluted using 10nM Tris-HCl, pH 8.0 or 0.1X TE.

Check the DNA concentration of your samples using the Fragment Analyzer Genomic DNA 50Kb kit (DNF-467-0500).
Normalise all samples based on the Fragment Analyzer results. The DNA input (ng) should be close to equal for all samples before proceeding with the library prep.
Concentrate plates using the Eppendorf Concentrator (SpeedVac) if starting concentrations are low.
NEBNext End Prep
Thaw the NEBNext Ultra II End Prep Enzyme MixNew England BiolabsCatalog #E7646 and NEBNext dA-Tailing Reaction Buffer - 2.0 mlNew England BiolabsCatalog #B6059S , place the Enzyme Mix on ice.

Gently mix and spin down the components before use.

Prepare a master mix of the NEBNext Ultra II End Prep Enzyme MixNew England BiolabsCatalog #E7646 and NEBNext dA-Tailing Reaction Buffer - 2.0 mlNew England BiolabsCatalog #B6059S based on the volume option you choose to work with.

ABCD
Volume option 1 (1:8)Volume option 2 (1:12)Volume option 3 (1:16)
NEBNext Ultra II End Prep Enzyme Mix0,3750,250,15
NEBNext Ultra II End Prep Reaction Buffer 0,8750,580,35
Fragmented DNA (can be adjust with 0,1 xTE)6,264,172,5
Total volume7,553
Table 1: Amount (μl) per volume option.

  • Let the I.DOT Mini distribute the appropriate volume of the master mix:
  • Option 1: 1.25 µL , 0ption 2: 0.83 µL , and option 3: 0.5 µL
  • I.DOT Liquid setting: H20.
  • Manually add the appropriate amount of fragmented DNA (see Table 1) using a P10 multichannel.
  • Gently mix by slowly pipetting the entire volume up and down at least 10 times.
Place in a thermocycler, with the heated lid set to ≥ 75 °C , and run the following program: 00:30:00 at 20 °C 00:30:00 at 65 °C Hold at4 °C
1h
NEBNext Adaptor Ligation
30m
Thaw the NEBNext Ligation Master MixNew England BiolabsCatalog #E7648AAVIAL , NEBNext® Ligation EnhancerNew England BiolabsCatalog #E7374AAVIAL & NEBNext Adaptor for IlluminaNew England BiolabsCatalog #E7337 in Kits E7335, E7500, E771 and place on ice.
Important note: Before starting the Adapter Ligation, determine whether adaptor dilution* is necessary:
ABC
InputADAPTOR DILUTION (VOLUME OF ADAPTOR: TOTAL VOLUME)WORKING ADAPTOR CONCENTRATION
1 µg–101 ngNo Dilution15 µM
100 ng–5 ng10-Fold (1:10)1.5 µM
less than 5 ng25-Fold (1:25)0.6 µM
Table 2: Input Adaptor Dilution.

  • Prepare an Adaptor dilution in Tris/NaCl, pH 8.0 (10 mM Tris, 10mM NaCl) if necessary.
*The NEB adaptor sequence: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCCTACACGACGCTCTTCCGATC*T
  • Prepare a Master Mix of the Ligation Master Mix & Ligation Enhancer based on the volume option chosen (see Table 3).
  • Let the I.DOT Mini pipet the appropriate volume of your master mix to the End Prep Reaction Mixture.
  • Option 1: 3.875 µL , option 2: 2.583 µL , and option 3: 1.55 µL .
- Liquid class:
  • Let the I.DOT Mini pipet the appropriate volume of your NEBNext Adaptor for Illumina. - Liquid class: H20.
ABCD
Volume option 1 (1:8)Volume option 2 (1:12)Volume option 3 (1:16)
End Prep Reaction Mixture from step 17,5 μl5 μl3 μl
NEBNext Ultra II Ligation Master Mix* 3,75 μl2,5 μl1,5 μl
NEBNext Ligation Enhancer0,125 μl0,083 μl0,05 μl
NEBNext Adaptor for Illumina0,31 μl0,208 μl0,0125 μl
Total Volume11,41 μl7,79 μl4,56 μl
Table 3: Amount (μl) per volume option.

  • Mix by pipetting the entire volume up and down at least 10 times.
  • Spin down briefly.

Incubate at 20 °C for 00:15:00 in a thermocycler with the heated lid of
15m
  • Let the I.DOT pipet the appropriate volume (see Table 4) of the NEB USER® EnzymeNew England BiolabsCatalog #M5505S/L to the ligation mixture:
ABCD
USER Enzyme0,5 μl0,35 μl0,2 μl
Table 4: Amount (μl) per volume option.
Liquid class: Glycerol 10%
Mix well and incubate at 37 °C for00:15:00 with the heated lid set to ≥47 °C
15m
Bring the volume of the total reaction to 15 µL before proceeding to the following step.

1,2X Reaction Clean-up
  • Let the MN beads get to room temperature (remove from fridge 15 min before use).
  • Prepare fresh 80% EtOH (200 µL per sample, e.g. 41.7 mL EtOH 96% + 8.3 mL MilliQ).
  • Mix the MN beads well by vortexing.
  • Add 1,2x MN beads to the ligation reaction.
  • Mix well by pipetting.
  • Incubate at room temperature for 00:05:00 .
  • Place the plate on the magnetic rack.
  • When the solution is clear (00:05:00 ), carefully remove the supernatant (LEAVE THE PLATE ON THE MAGNET).
  • Wash the beads 2x with 50 µL 80% ethanol (LEAVE THE PLATE ON THE MAGNET).
  • Let the beads air dry for 00:01:00 (LEAVE THE PLATE ON THE MAGNET).
  • Take the plate off the magnet and resuspend the beads with e.g.12 µL 0,1x TE, by pipetting up and down.
  • Wait 00:05:00 and put the plate back on the magnet.
  • When the solution is clear (00:05:00 ), move 12 µL of the supernatant to a clean plate.
NOTE: The plate can be concentrated again in the Eppendorf Concentrator (SpeedVac) if volume option 2 or volume option 3 is chosen and low concentrations are expected.


21m
NEBNext PCR Enrichment
30m
  • Distribute the NEBNext Ultra II Q5 Master Mix - 250 rxnsNew England BiolabsCatalog #M0544L with the chosen volume option to all wells of a new PCR plate.
  • Add the Adaptor Ligated DNA Fragments and IDT_10 primers manually using a P10 multichannel.
ABCD
Volume option 1 (1:8)Volume option 2 (1:12)Volume option 3 (1:16)
Adaptor Ligated DNA Fragments 5,25 μl3,15 μl2,1 μl
NEBNext Ultra II Q5 Master Mix 2X6,25 μl3.75 μl2,5 μl
Illumina IDT_10 i7 Primer*0,5 μl0,3 μl0,2 μl
Illumina IDT_10 i5 Primer*0,5 μl0,3 μl0,2 μl
Total volume12,5 μl7,5 μl5 μl
Table 5: Amount (μl) per volume option.

  • Mix by pipetting the entire volume up and down at least 10 times
  • Place the plate in a thermocycler and perform PCR amplification using the following PCR cycling conditions
ABCD
Cycle StepTempTimeCycles
Initial Denaturation98°C30 seconds1
Denaturation98°C10 seconds3–15*
Annealing/Extension65°C75 seconds
Final Extension65°C5 minutes1
Hold4°C
Table 6: PCR program

The number of PCR cycles should be chosen based on input amount and sample type (see Table 7). Thus, samples prepared with a different method prior to library prep may require re-optimization of the number of PCR cycles. The number of cycles should be high enough to provide sufficient library fragments for a successful sequencing run, but low enough to avoid PCR artifacts and over-cycling (high molecular weight fragments on TapeStation or Fragment Analyzer). Use the table below for applications requiring high library yields (~1 µg ).
AB
INPUT DNA IN THE END PREP REACTION# OF CYCLES REQUIRED FOR TARGET ENRICHMENT LIBRARY PREP (~1 µg):
1 µg*3–4*, **
500 ng*4–5*
100 ng*6–7*
50 ng7–8
10 ng9–10
5 ng10–11
1 ng12–13
0.5 ng14–15
Table 7: Number of cycles per input DNA.

Check PCR succes
  • Check the success of a few amplified samples on the TapeStation using the D5000 High Sensitivity kit:
  • Dilute1 µL of amplified sample in 9 µL of MilliQ (10x) and measure the sample. - Optional: add 0.2 µL of amplified sample and 1.8 µL of MilliQ directly to the TapeStation strip.
  • If the amplification was not sufficient, add additional cycles.
  • If overcycling has occurred, redo the amplification with the remaining sample from the previous step with fewer cycles.

  • Bring the volume of the PCR reaction to at least 10 µL before proceeding to the next step.
Reaction Clean-up
16m
  • Let the MN beads get to room temperature (remove from fridge 15 min before use).
  • Prepare fresh 80% EtOH (200 µL per sample, e.g. 41.7 mL EtOH 96% + 8.3 mL MilliQ).
  • Mix the MN beads well by vortexing.
  • Add 0,9x MN beads* to the ligation reaction.
  • Mix well by pipetting.
  • Incubate at room temperature for 00:05:00 .
  • Place the plate on the magnetic rack.
  • When the solution is clear (00:05:00 ), carefully remove the supernatant (LEAVE THE PLATE ON THE MAGNET).
  • Wash the beads 2x with 50 µL 80% ethanol (LEAVE THE PLATE ON THE MAGNET).
  • Let the beads air dry for 00:01:00 (LEAVE THE PLATE ON THE MAGNET).
  • Take the plate off the magnet and resuspend the beads with e.g.12 µL 0,1x TE, by pipetting up and down.
  • Place the plate back on the magnet.
  • When the solution is clear (00:05:00 ), move 12 µL of the supernatant to a clean plate.

*Bead to sample ratio is dependent on the library size. Carefully choose the correct ratio.
16m
Measuring libraries and equimolar pooling of samples
  • Measure the concentration of all samples on the Fragment Analyzer.
  • Export a smear analysis and pool all samples equimolarly by either using the Qiagility pipetting robot or manually.

Measuring pools
  • Measure the pool(s) in triplicate on the TapeStation using the High Sensitivity D5000 kit.
  • Use the mean concentration per pool for calculations.
  • If equimolar pooling of subpools is required, use the average molar concentration of the three measured subpools for pooling of these pools (calculate this based on the lowest pool concentration).