May 13, 2020
Version 2
nCoV-2019 sequencing protocol (RAPID barcoding, 1200bp amplicon) V.2
Version 1 is forked from nCoV-2019 sequencing protocol v2 (GunIt)
- 1Massey University
- Coronavirus Method Development Community
Protocol Citation: Nikki Freed, Olin Silander 2020. nCoV-2019 sequencing protocol (RAPID barcoding, 1200bp amplicon). protocols.io https://dx.doi.org/10.17504/protocols.io.bgc8jszw
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: May 13, 2020
Last Modified: May 13, 2020
Protocol Integer ID: 36992
Abstract
To enable faster, easier sequencing of SARS-COV2 genomes with fewer steps than current methods, we use multiplexed 1200 base pair PCR amplicons with the Oxford Nanopore RAPID barcoding kit (RBK004).
This is a modification of the ARTIC amplicon V3 sequencing protocol for MinION for nCoV-2019 developed by Josh Quick, which produces 400 base pair amplicons and uses the Oxford Nanopore Ligation barcoding kit (LSK-109).
We have increased the size of the amplicons to 1200bp and use the RAPID barcode kit (RBK004), which enables requires less time and fewer reagents than the LSK-109 protocol. The amplicons produced in this protocol could also be used for Illumina sequencing.
Primers were all designed using Primal Scheme: http://primal.zibraproject.org/, described here https://www.nature.com/articles/nprot.2017.066.
Primer sequences are here: https://docs.google.com/spreadsheets/d/1M5I_C56ZC8_2Ycgm9EFieVlVNqxsP7dXAnGoBZy3nDo/edit?usp=sharing
We can ship a small amount of pooled primers to interested labs for further testing, email freednikki@gmail.com or olinsilander@gmail.com
Guidelines
This has so far been testing using only five SARS-CoV2 patient positive samples, with Cq values ranging from 20 to 31. Further testing might be needed to test the method on low viral load samples/high Cq samples.
Materials
STEP MATERIALS
- Primers 25nm, desalted, ideally LabReady formulation from IDT: https://docs.google.com/spreadsheets/d/1M5I_C56ZC8_2Ycgm9EFieVlVNqxsP7dXAnGoBZy3nDo/edit#gid=755704891
- Extraction kits; Zymo Quick-RNA Viral Kit Zymo R1034
OR
- i.e. QIAamp Viral RNA Mini Qiagen 52904
- SuperScript IV (50 rxn) Thermo 18090050
- dNTP mix (10 mM each) Thermo R0192
- Random Hexamers (50 µM) Thermo N8080127
OR
- Random Primer Mix (60 µM) NEB S1330S
- RNase OUT (125 rxn) Thermo 10777019
- Q5 Hot Start HF Polymerase NEB M0493S
- Rapid Barcoding Kit 1-12 Nanopore SQK-RBK004
- R9.4.1 flow cell Nanopore FLO-MIN106
Protocol materials
SQK-RBK004 Rapid Barcoding KitOxford Nanopore TechnologiesCatalog #SQK-RBK004
Safety warnings
Please follow standard health and safety guidelines when working with COVID-19 patient samples.
cDNA preparation
cDNA preparation
5m
5m
Mix the following components in an 0.2mL 8-strip tube;
Component Volume
50µM random hexamers 1 µL
10mM dNTPs mix (10mM each) 1 µL
Template RNA 11 µL
Total 13 µL
Note
Viral RNA input from a clinical sample should be between Ct 18-35. If Ct is between 12-15, then dilute the sample 100-fold in water, if between 15-18 then dilute 10-fold in water. This will reduce the likelihood of PCR-inhibition. It is good practice to carry a negative control (e.g. water) through the entire process from cDNA preparation to sequencing.
Note
A mastermix should be made up in the mastermix cabinet and aliquoted into PCR strip tubes. Tubes should be wiped down when entering and leaving the mastermix cabinet.
5m
Gently mix by pipetting and pulse spin the tube to collect liquid at the bottom of the tube.
Incubate the reaction as follows:
65 °C for 00:05:00
Snap cool in a prechilled metal rack or on ice 00:01:00
Note
A quick cooling step using a PCR cooling block or ice helps to inhibit secondary structure formation and can decrease variation in overall coverage.
6m
Add the following to the annealed template RNA :
Component Volume
SSIV Buffer 4 µL
100mM DTT 1 µL
RNaseOUT RNase Inhibitor 1 µL
SSIV Reverse Transcriptase 1 µL
Total 20 µL
Note
A mastermix should be made up in the mastermix cabinet and added to the denatured RNA in the extraction and sample addition cabinet. Tubes should be wiped down when entering and leaving the mastermix cabinet.
5m
Gently mix by pipetting and pulse spin the tube to collect liquid at the bottom of the tube.
Incubate the reaction in a preheated PCR machine:
42 °C 00:50:00
70 °C 00:10:00
Hold at 5 °C
1h 5m
Primer pool preparation
Primer pool preparation
If required, resuspend lyophilised primers at a concentration of 100µM each
Note
Primers for this protocol were designed using Primal Scheme and generate overlapping 1200nt amplicons. Primer names and dilutions are listed here: https://docs.google.com/spreadsheets/d/1M5I_C56ZC8_2Ycgm9EFieVlVNqxsP7dXAnGoBZy3nDo/edit?usp=sharing.
We have tested multiplexing 1500 nt and 2000 nt amplicons as well, all work well. These are included in the link. Here we will discuss just the protocol for 1200 nt amplicons as this longer amplicons might be sensitive to RNA degradation.
Primers used to generate 1200 bp amplicons are here:
| Primer Name | Sequence | Pool | Length | Tm | GC% | Start | |
| SARSCoV_1200_1_LEFT | ACCAACCAACTTTCGATCTCTTGT | 1 | 24 | 60.69 | 41.67 | 30 | |
| SARSCoV_1200_1_RIGHT | GGTTGCATTCATTTGGTGACGC | 1 | 22 | 61.49 | 50 | 1205 | |
| SARSCoV_1200_3_LEFT | GGCTTGAAGAGAAGTTTAAGGAAGGT | 1 | 26 | 61.19 | 42.31 | 2153 | |
| SARSCoV_1200_3_RIGHT | GATTGTCCTCACTGCCGTCTTG | 1 | 22 | 61.5 | 54.55 | 3257 | |
| SARSCoV_1200_5_LEFT | ACCTACTAAAAAGGCTGGTGGC | 1 | 22 | 60.55 | 50 | 4167 | |
| SARSCoV_1200_5_RIGHT | AGCATCTTGTAGAGCAGGTGGA | 1 | 22 | 61.16 | 50 | 5359 | |
| SARSCoV_1200_7_LEFT | ACCTGGTGTATACGTTGTCTTTGG | 1 | 24 | 60.8 | 45.83 | 6283 | |
| SARSCoV_1200_7_RIGHT | GCTGAAATCGGGGCCATTTGTA | 1 | 22 | 61.53 | 50 | 7401 | |
| SARSCoV_1200_9_LEFT | AGAAGTTACTGGCGATAGTTGTAATAACT | 1 | 29 | 60.59 | 34.48 | 8253 | |
| SARSCoV_1200_9_RIGHT | TGCTGATATGTCCAAAGCACCA | 1 | 22 | 60.29 | 45.45 | 9400 | |
| SARSCoV_1200_11_LEFT | AGACACCTAAGTATAAGTTTGTTCGCA | 1 | 27 | 60.74 | 37.04 | 10343 | |
| SARSCoV_1200_11_RIGHT | GCCCACATGGAAATGGCTTGAT | 1 | 22 | 61.8 | 50 | 11469 | |
| SARSCoV_1200_13_LEFT | ACCTCTTACAACAGCAGCCAAAC | 1 | 23 | 61.55 | 47.83 | 12450 | |
| SARSCoV_1200_13_RIGHT | CGTCCTTTTCTTGGAAGCGACA | 1 | 22 | 61.38 | 50 | 13621 | |
| SARSCoV_1200_15_LEFT | TTTTAAGGAATTACTTGTGTATGCTGCT | 1 | 28 | 60.06 | 32.14 | 14540 | |
| SARSCoV_1200_15_RIGHT | ACACACAACAGCATCGTCAGAG | 1 | 22 | 61.12 | 50 | 15735 | |
| SARSCoV_1200_17_LEFT | TCAAGCTTTTTGCAGCAGAAACG | 1 | 23 | 61.28 | 43.48 | 16624 | |
| SARSCoV_1200_17_RIGHT | CCAAGCAGGGTTACGTGTAAGG | 1 | 22 | 61.19 | 54.55 | 17754 | |
| SARSCoV_1200_19_LEFT | GGCACATGGCTTTGAGTTGACA | 1 | 22 | 61.91 | 50 | 18596 | |
| SARSCoV_1200_19_RIGHT | CCTGTTGTCCATCAAAGTGTCCC | 1 | 23 | 61.62 | 52.17 | 19678 | |
| SARSCoV_1200_21_LEFT | TCTGTAGTTTCTAAGGTTGTCAAAGTGA | 1 | 28 | 60.58 | 35.71 | 20553 | |
| SARSCoV_1200_21_RIGHT | GCAGGGGGTAATTGAGTTCTGG | 1 | 22 | 60.95 | 54.55 | 21642 | |
| SARSCoV_1200_23_LEFT | ACTTTAGAGTCCAACCAACAGAATCT | 1 | 26 | 60.18 | 38.46 | 22511 | |
| SARSCoV_1200_23_RIGHT | TGACTAGCTACACTACGTGCCC | 1 | 22 | 61.52 | 54.55 | 23631 | |
| SARSCoV_1200_25_LEFT | TGCTGCTACTAAAATGTCAGAGTGT | 1 | 25 | 60.51 | 40 | 24633 | |
| SARSCoV_1200_25_RIGHT | CATTTCCAGCAAAGCCAAAGCC | 1 | 22 | 61.45 | 50 | 25790 | |
| SARSCoV_1200_27_LEFT | TGGATCACCGGTGGAATTGCTA | 1 | 22 | 61.75 | 50 | 26744 | |
| SARSCoV_1200_27_RIGHT | TGTTCGTTTAGGCGTGACAAGT | 1 | 22 | 60.74 | 45.45 | 27894 | |
| SARSCoV_1200_29_LEFT | TGAGGGAGCCTTGAATACACCA | 1 | 22 | 61.1 | 50 | 28677 | |
| SARSCoV_1200_29_RIGHT | TAGGCAGCTCTCCCTAGCATTG | 1 | 22 | 61.61 | 54.55 | 29790 |
Primers for Pool 1
| Primer Name | Sequence | Pool | Length | Tm | GC% | Start | |
| SARSCoV_1200_2_LEFT | CCATAATCAAGACTATTCAACCAAGGGT | 2 | 28 | 61.27 | 39.29 | 1100 | |
| SARSCoV_1200_2_RIGHT | ACAGGTGACAATTTGTCCACCG | 2 | 22 | 61.33 | 50 | 2266 | |
| SARSCoV_1200_4_LEFT | GGAATTTGGTGCCACTTCTGCT | 2 | 22 | 61.66 | 50 | 3144 | |
| SARSCoV_1200_4_RIGHT | CCTGACCCGGGTAAGTGGTTAT | 2 | 22 | 61.49 | 54.55 | 4262 | |
| SARSCoV_1200_6_LEFT | ACTTCTATTAAATGGGCAGATAACAACTG | 2 | 29 | 60.18 | 34.48 | 5257 | |
| SARSCoV_1200_6_RIGHT | GATTATCCATTCCCTGCGCGTC | 2 | 22 | 61.75 | 54.55 | 6380 | |
| SARSCoV_1200_8_LEFT | CAATCATGCAATTGTTTTTCAGCTATTTTG | 2 | 30 | 60.39 | 30 | 7298 | |
| SARSCoV_1200_8_RIGHT | TGACTTTTTGCTACCTGCGCAT | 2 | 22 | 61.39 | 45.45 | 8385 | |
| SARSCoV_1200_10_LEFT | TTTACCAGGAGTTTTCTGTGGTGT | 2 | 24 | 60.32 | 41.67 | 9303 | |
| SARSCoV_1200_10_RIGHT | TGGGCCTCATAGCACATTGGTA | 2 | 22 | 61.5 | 50 | 10451 | |
| SARSCoV_1200_12_LEFT | ATGGTGCTAGGAGAGTGTGGAC | 2 | 22 | 61.48 | 54.55 | 11372 | |
| SARSCoV_1200_12_RIGHT | GGATTTCCCACAATGCTGATGC | 2 | 22 | 60.48 | 50 | 12560 | |
| SARSCoV_1200_14_LEFT | ACAGGCACTAGTACTGATGTCGT | 2 | 23 | 61.12 | 47.83 | 13509 | |
| SARSCoV_1200_14_RIGHT | GTGCAGCTACTGAAAAGCACGT | 2 | 22 | 61.94 | 50 | 14641 | |
| SARSCoV_1200_16_LEFT | ACAACACAGACTTTATGAGTGTCTCT | 2 | 26 | 60.18 | 38.46 | 15608 | |
| SARSCoV_1200_16_RIGHT | CTCTGTCAGACAGCACTTCACG | 2 | 22 | 61.17 | 54.55 | 16720 | |
| SARSCoV_1200_18_LEFT | GCACATAAAGACAAATCAGCTCAATGC | 2 | 27 | 62.03 | 40.74 | 17622 | |
| SARSCoV_1200_18_RIGHT | TGTCTGAAGCAGTGGAAAAGCA | 2 | 22 | 60.68 | 45.45 | 18706 | |
| SARSCoV_1200_20_LEFT | ACAATTTGATACTTATAACCTCTGGAACAC | 2 | 30 | 60.15 | 33.33 | 19574 | |
| SARSCoV_1200_20_RIGHT | GATTAGGCATAGCAACACCCGG | 2 | 22 | 61.39 | 54.55 | 20698 | |
| SARSCoV_1200_22_LEFT | GTGATGTTCTTGTTAACAACTAAACGAACA | 2 | 30 | 61.44 | 33.33 | 21532 | |
| SARSCoV_1200_22_RIGHT | AACAGATGCAAATCTGGTGGCG | 2 | 22 | 62.03 | 50 | 22612 | |
| SARSCoV_1200_24_LEFT | GCTGAACATGTCAACAACTCATATGA | 2 | 26 | 60.13 | 38.46 | 23518 | |
| SARSCoV_1200_24_RIGHT | ATGAGGTGCTGACTGAGGGAAG | 2 | 22 | 61.74 | 54.55 | 24736 | |
| SARSCoV_1200_26_LEFT | GCCTTGAAGCCCCTTTTCTCTA | 2 | 22 | 60.29 | 50 | 25690 | |
| SARSCoV_1200_26_RIGHT | AATGACCACATGGAACGCGTAC | 2 | 22 | 61.5 | 50 | 26857 | |
| SARSCoV_1200_28_LEFT | TTTGTGCTTTTTAGCCTTTCTGCT | 2 | 24 | 60.14 | 37.5 | 27784 | |
| SARSCoV_1200_28_RIGHT | GTTTGGCCTTGTTGTTGTTGGC | 2 | 22 | 61.82 | 50 | 29007 |
Primers for Pool 2
Generate primer pool stocks by adding 5 µL of each odd region primer to a 1.5 mL Eppendorf labelled “Pool 1 (100µM)” and each even region primer to a 1.5 mL Eppendorf labelled “Pool 2 (100µM)”. The pool is also given in the link above. These are your 100µM stocks of each primer pool.
Note
Primers should be diluted and pooled in the mastermix cabinet which should be cleaned with decontamination wipes and UV sterilised before and after use.
Dilute this primer pool 1:10 in molecular grade water, to generate 10µM primer stocks. It is recommend that multiple aliquots of each primer pool are made to in case of degradation or contamination.
Note
Primers need to be used at a final concentration of 0.015µM per primer. In this case (1200 nt amplicons), pool 1 has 30 primers and pool 2 has 28 primers, so the requirement is 1.13µL for primer pool 1 and 1.05µL for primer pool 2 (10uM) per 25µL reaction. However, as these values are relatively close, we round up and down to 1.1ul for both pools, so the pools can be made in a similar fashion. For other schemes, adjust the volume added appropriately.
Multiplex PCR
Multiplex PCR
In the mastermix hood set up the multiplex PCR reactions as follows in 0.2mL 8-strip PCR tubes:
Component Pool 1 Pool 2
5X Q5 Reaction Buffer 5 µL 5 µL
10 mM dNTPs 0.5 µL 0.5 µL
Q5 Hot Start DNA Polymerase 0.25 µL 0.25 µL
Primer Pool 1 or 2 (10µM) 1.1 µL 1.1 µL
Nuclease-free water 15.9 µL 15.9 µL
Total 22.5 µL 22.5 µL
Note
A PCR mastermix for each pool should be made up in the mastermix cabinet and aliquoted into PCR strip tubes. Tubes should be wiped down when entering and leaving the mastermix cabinet.
In the extraction and sample addition cabinet add 2.5 µL cDNA to each tube and mix well by pipetting.
Note
The extraction and sample addition cabinet should should be cleaned with decontamination wipes and UV sterilised before and after use.
Pulse centrifuge the tubes to collect the contents at the bottom of the tube.
Set-up the following program on the thermal cycler:
Step Temperature Time Cycles
Heat Activation 98 °C 00:00:30 1
Denaturation 98 °C 00:00:15 25-35
Annealing and Extension 65 °C 00:05:00 25-35
Hold 4 °C Indefinite 1
Note
Cycle number should be 25 for Ct 18-21 up to a maximum of 35 cycles for Ct 35.
Expected result
Final concentrations of PCR products can range from 20- 150ng/ul.
2h 40m
Pooling and PCR quantification
Pooling and PCR quantification
Label a 1.5 mL Eppendorf tube for each sample and combine the two pools the PCR reaction as follows:
Component Volume
Pool 1 PCR reaction 25 µL
Pool 2 PCR reaction 25 µL
Total 50 µL
Note
At this stage, care should be taken with amplified PCR products. Only open tubes in a designated post-PCR workspace with equipment that is separate from areas where primers and mastermixes are handled.
After combining the two pools of amplified DNA, the PCR products can be used for Oxford Nanopore Sequencing, using the RAPID barcode kit RBK004, as described in this protocol (below, Steps 15 onward).
Alternatively, these amplicons can be used for Oxford Nanopore Sequencing, following Josh Quick's ligation based protocol (CoV-2019 sequencing protocol v2, dx.doi.org/10.17504/protocols.io.bdp7i5rn, at step 15) using the SQK-LSK109 kit.
Alternatively, these amplicons can also be used for Illumina sequencing, such as found here: x.doi.org/10.17504/protocols.io.betejeje
We have found that performing an Ampure XP bead clean up at this stage does not improve performance. Therefore, do not clean up the PCR reaction at this step.
Quantify DNA using a Qubit or other method. Quantification using Nanodrop is not recommended.
Protocol
NAME
DNA quantification using the Qubit fluorometerCREATED BY
Nikki Freed
Prepare a mastermix of Qubit™ working solution for the required number of samples and standards. The Qubit dsDNA kit requires 2 standards for calibration (see note below).
Per sample:
Qubit® dsDNA HS Reagent 1 µL
Qubit® dsDNA HS Buffer 199 µL
Note
If you have already performed a calibration on the Qubit machine for the selected assay you can use the previous calibration stored on the machine. We recommend performing a new calibration for every sample batch but a same-day calibration would be fine to use for multiple batches.
To avoid any cross-contamination, we recommend that you remove the total amount of working solution required for your samples and standards from the working solution bottle and then add the required volume to the appropriate tubes instead of pipetting directly from the bottle to each tube.
Label the tube lids. Do not label the side of the tube as this could interfere with the sample reading.
Note
Use only thin-wall, clear, 0.5mL PCR tubes. Acceptable tubes include Qubit™ assay tubes (Cat. No. Q32856)
Aliquot Qubit™ working solution to each tube:
- standard tubes requires 190µL of Qubit™ working solution
- sample tubes require anywhere from 180–199µL (depending how much sample you wish to add).
The final volume in each tube must be 200µL once sample/standard has been added.
Add 10µL of standard to the appropriate tube.
Add 1–20µL of each user sample to the appropriate tube.
Note
If you are adding 1–2µL of sample, use a P-2 pipette for best results.
Mix each tube vigorously by vortexing for 3–5 seconds.
Allow all tubes to incubate at room temperature for 2 minutes, then proceed to “Read standards and samples”.
On the Home screen of the Qubit™ 3 Fluorometer, press DNA, then select 1X dsDNA HS as the assay type. The Read standards screen is displayed. Press Read Standards to proceed.
Note
If you have already performed a calibration for the selected assay, the instrument prompts you to choose between reading new standards and running samples using the previous calibration. If you want to use the previous calibration, skip to step 12. Otherwise, continue with step 9.
Insert the tube containing Standard #1 into the sample chamber, close the lid, then press Read standard. When the reading is complete (~3 seconds), remove Standard #1.
Insert the tube containing Standard #2 into the sample chamber, close the lid, then press Read standard. When the reading is complete, remove Standard #2.
The instrument displays the results on the Read standard screen. For information on interpreting the calibration results, refer to the Qubit™ Fluorometer User Guide, available for download at thermofisher.com/qubit.
Press Run samples.
On the assay screen, select the sample volume and units:
- Press the + or – buttons on the wheel, or anywhere on the wheel itself, to select the sample volume added to the assay tube (from 1–20µL).
- From the unit dropdown menu, select the units for the output sample concentration (in this case choose ng/µL).
Insert a sample tube into the sample chamber, close the lid, then press Read tube. When the reading is complete (~3 seconds), remove the sample tube.
The top value (in large font) is the concentration of the original sample and the bottom value is the dilution concentration. For information on interpreting the sample results, refer to the Qubit™ Fluorometer User Guide.
Repeat step 14 until all samples have been read.
Carefully record all results and store run file from the Qubit on a memory stick.
All negative controls should ideally be ‘too low’ to read on the Qubit machine, but MUST be < 1ng per ul. If your negative controls >1ng per ul, considerable contamination has occurred and you must redo previous steps.
Normalisation
Normalisation
Label a 0.2 mL PCR tube for each sample.
Adjust the amount of DNA in the tube to be 100 ng total per sample in 7.5 µL molecular grade water. For example if your PCR reaction is at 100ng/ul, add 1ul of the PCR reaction to 6.5ul of molecular grade water. Input to the Rapid Barcoding kit will vary depending on the amplicon length but we have determined 50-200 ng works for efficient barcoding of this amplicon length. Use 7.5ul of the negative control, even if there is no detectable DNA in the PCR reaction.
Rapid barocoding using the SQK RBK004
Rapid barocoding using the SQK RBK004
Mulitple samples can be run on the same flow cell by barcoding. Up to 12 samples at a time can be run. Amplicons from each sample will be individually barcoded in the following steps. These follow the RBK004 protocol from Oxford Nanopore. It is highly recommended to use their protocol for the following steps.
SQK-RBK004 Rapid Barcoding KitOxford Nanopore TechnologiesCatalog #SQK-RBK004
Add 7.5 µL of each diluted PCR reaction from step 15 to the labeled PCR tube.
Set up the following reaction for each sample:
Component Volume
DNA amplicons from step 15 (100ng total) 7.5 µL
Fragmentation Mix RB01-12 (one for each sample, included in kit) 2.5 µL
Total 10 µL
5m
Mix gently by flicking the tube, and spin down.
Incubate the reaction in a PCR machine:
30 °C for 00:01:00
80 °C for 00:01:00
4 °C for 00:00:30
5m
Pool all barcoded samples, noting the total volume.
Ampure Bead Cleanup. Use a 1:1 ratio of sample to beads.
Protocol
NAME
Amplicon clean-up using SPRI beads
CREATED BY
Nikki Freed
15m
Vortex SPRI beads thoroughly to ensure they are well resuspended, the solution should be a homogenous brown colour.
Agencourt AMPure XPBeckman CoulterCatalog #A63880
Add an equal volume (1:1) of SPRI beads to the sample tube and mix gently by either flicking or pipetting. For example add 50 µL room temperature SPRI beads to a 50 µL reaction.
Pulse centrifuge to collect all liquid at the bottom of the tube.
Incubate for 00:05:00 at room temperature.
Place on magnetic rack and incubate for 00:02:00 or until the beads have pelleted and the supernatant is completely clear.
Carefully remove and discard the supernatant, being careful not to touch the bead pellet.
Add 200 µL of freshly prepared room-temperature 80 % volume ethanol to the pellet.
Keeping the magnetic rack on the benchtop, rotate the bead-containing tube by 180°. Wait for the beads to migrate towards the magnet and re-form a pellet. Remove the ethanol using a pipette and discard.
and repeat ethanol wash.
Pulse centrifuge to collect all liquid at the bottom of the tube and carefully remove as much residual ethanol as possible using a P10 pipette.
With the tube lid open incubate for 00:01:00 or until the pellet loses it's shine (if the pellet dries completely it will crack and become difficult to resuspend).
Remove the tube from the magnetic rack. Resuspend pellet in 10 µL molecular grade water or Elution buffer, mix gently by flicking and incubate for 00:02:00 .
Elution Buffer (EB)QiagenCatalog #19086
Place on magnet and transfer sample to a clean 1.5mL Eppendorf tube ensuring no beads are transferred into this tube.
Quantify 1 µL product using the Quantus Fluorometer using the ONE dsDNA assay.
QuantiFluor(R) ONE dsDNA System, 100rxnPromegaCatalog #E4871
Equipment
Quantus
NAME
Fluorometer
TYPE
Promega
BRAND
E6150
SKU
LINK
Add 1 µL of RAP (from the RBK004 kit) to 10 µL cleaned, barcoded DNA from step 17 . Mix gently by flicking the tube, and spin down.
1m
Incubate the reaction for 00:05:00 at room temperature.
5m
The prepared library is used for loading into the MinION flow cell according to Oxford Nanopore Rapid Barcoding (RBK004) protocol. Store the library on ice until ready to load.
10m
MinION sequencing
MinION sequencing
Start the sequencing run using MinKNOW.
Protocol
NAME
Starting a MinION sequencing run using MinKNOW
CREATED BY
Nikki Freed
If required plug the MinION into the computer and wait for the MinION and flowcell to ben detected.
Choose flow cell 'FLO-MIN106' from the drop-down menu.
Then select the flowcell so a tick appears.
Click the 'New Experiment' button in the bottom left of the screen.
On the New experiment popup screen, select the running parameters for your experiment from the individual tabs:
Experiment: Name the run in the experiment field, leave the sample field blank.
Kit: Selection: Select RBK004
Run Options: Set the run length to 6 hours (you can stop the run once sufficient data has been collected as determined using RAMPART).
Basecalling: Select 'fast basecalling'.
Output: The number of files that MinKNOW will write to a single folder. By default this is set to 4000 but can be reduced to make RAMPART update more frequently.
Click 'Start run'.
Monitor the progress of the run using the MinKNOW interface.
Depending on the variation in coverage of each amplicon, generally, you will need approx 10,000 to 20,000 reads or 10-20Mb per sample to confidently assemble and call variants. This can typically be achieved on a minION flow cell in under two hours when runnning 12 samples. Shorter, if running fewer samples.
The primer scheme .bed and .tsv files necessary for the ARTIC variant calling pipeline are here
.