Dec 14, 2022

nCoV-2019 Illumina Miniseq sequencing protocol (2,000bp amplicon)

  • 1CIAD AC Mazatlan;
  • 2CIAD
  • Juli : Julissa Enciso Ibarra;
Icon indicating open access to content
QR code linking to this content
Protocol CitationBruno Gomez-Gil, Juli 2022. nCoV-2019 Illumina Miniseq sequencing protocol (2,000bp amplicon). protocols.io https://dx.doi.org/10.17504/protocols.io.6qpvrdpjbgmk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 28, 2021
Last Modified: December 14, 2022
Protocol Integer ID: 47758
Keywords: sequencing protocol, illumina miniseq platform, nextera xt, amplicon, tagmentation with nextera xt, good sequence, protocol, much of this protocol
Funders Acknowledgements:
CONACYT
Grant ID: 321122
Disclaimer
It work for us, any modification is up to you.
Abstract
This is a fork of the protocol https://dx.doi.org/10.17504/protocols.io.bh7hj9j6 but modified for tiled 2000bp amplicons, tagmentation with Nextera XT, indexing, and sequencing with the Illumina Miniseq platform.
It has already produced very good sequences.
Much of this protocol is base on this paper: https://doi.org/10.1093/biomethods/bpaa014
Guidelines
Tested with high viral copy numbers (<30 Ct).
Materials
cDNA
Multiplex DNA

Library preparation

Protocol materials
GoScript™ Reverse Transcriptase KitPromegaCatalog #A5001
KAPA Taq HotStartMerck MilliporeSigma (Sigma-Aldrich)Catalog #KK1510
Nextera XT DNA Library Preparation KitIllumina, Inc.Catalog #FC-131-1024
Safety warnings
Please follow standard health and safety guidelines when working with COVID-19 patient samples.
Sample preparation
10m
Dilute the sample depending on the Ct values, this will reduce the likelihood of PCR-inhibition.

Ct range Sample Water

12-15 2 µL 198 µL
16-18 2 µL 18 µL
>18 no dilution

cDNA preparation
2h
We use theGoScript™ Reverse Transcriptase KitPromegaCatalog #A5001
Mix (pipetting) the following components in Eppendorf tube.

Component Volume
Nuclease-free water 4 µL
GoScriptTM Reaction Buffer, Random Primer 2 µL
GoScriptTM Enzyme Mix 0.4 µL
Final volume 10 µL
Note
It is good practice to carry a negative control (e.g. water) through the entire process from cDNA preparation to sequencing.

Note
The mastermix should be made up in the mastermix cabinet and aliquoted into PCR strip tubes. Tubes should be wiped down when entering and leaving the mastermix cabinet.


5m
Prepare the mastermix on ice, mix by pipetting.

Component Volume

GoScriptTM Reverse Transcription Mix 10 µL
RNA 3 µL
Final volume 13 µL


Incubate the reaction as follows:

Anneal primers 25 °C for 00:05:00
Extension 42 °C for 01:00:00
Inactivation 70 °C for 00:15:00

Snap cool in a prechilled metal rack or on ice 00:01:00
Note
A quick cooling step using a PCR cooling block or ice helps to inhibit secondary structure formation and can decrease variation in overall coverage.

Note
A mastermix should be made up in the mastermix cabinet and added to the denatured RNA in the extraction and sample addition cabinet. Tubes should be wiped down when entering and leaving the mastermix cabinet.

1h 21m
Primer pool preparation
PRIMERS for this protocol are described in protocol nCoV-2019 sequencing protocol (RAPID barcoding, 1200bp amplicon) and are the 2,000 bp option.
We selected for 2,000 bp amplicons so they could be more easily tagmented in the library preparation.
Two pooles are prepared, Pool1 with 18 primers and Pool2 with 16 primers.

POOL1. Average Tm 61.01 °C
ABCDEFGHIJKL
NameSequenceDirectionStartEndLengthProduct SizeTm%GCHairpin TmPair Dimer TmSelf Dimer Tm
SARSCoV_2000_01_LEFTACCAACCAACTTTCGATCTCTTGTforward315424204960.741.7NoneNoneNone
SARSCoV_2000_01_RIGHTACACCACCTGTAATGTAGGCCAreverse2058207922204961.45039None5
SARSCoV_2000_03_LEFTTCGCACAAATGTCTACTTAGCTGTforward3772379524181460.641.7None0.7None
SARSCoV_2000_03_RIGHTGTGTGCCCATGTACATAACAGCTreverse5563558523181461.247.842.70.78.3
SARSCoV_2000_05_LEFTCAATCATGCAATTGTTTTTCAGCTATTTTGforward7299732830182560.43033None7.4
SARSCoV_2000_05_RIGHTCGTGTGTCAGGGCGTAAACTTTreverse9102912322182561.650NoneNoneNone
SARSCoV_2000_07_LEFTGGACGTACCATATTGGGTAGTGCforward108861090823183460.852.243.8NoneNone
SARSCoV_2000_07_RIGHTTCTGTCGTAGTGCAACAGGACTreverse126981271922183461.35041.4None14
SARSCoV_2000_09_LEFTACCACTTCAGAGAGCTAGGTGTforward144771449822192560.550NoneNoneNone
SARSCoV_2000_09_RIGHTACAACCTGGAGCATTGCAAACAreverse163801640122192561.545.5NoneNone11.9
SARSCoV_2000_11_LEFTTGGCATACCTAAGGACATGACCTforward181681819023181460.947.838.3None11.2
SARSCoV_2000_11_RIGHTCAGTGAGTGGTGCACAAATCGTreverse199601998122181461.65038.7None20.4
SARSCoV_2000_13_LEFTTCCTCAGTTTTACATTCAACTCAGGAforward216952172026193760.238.545.2None0.9
SARSCoV_2000_13_RIGHTTGACTAGCTACACTACGTGCCCreverse236102363122193761.554.537NoneNone
SARSCoV_2000_15_LEFTAGGAGTCAAATTACATTACACATAAACGAAforward253602538930180560.130NoneNoneNone
SARSCoV_2000_15_RIGHTACTGCTACTGGAATGGTCTGTGTreverse271422716423180561.647.8NoneNoneNone
SARSCoV_2000_17_LEFTACTTGTCACGCCTAAACGAACAforward278732789422191860.745.536.7NoneNone
SARSCoV_2000_17_RIGHTTAGGCAGCTCTCCCTAGCATTGreverse297692979022191861.654.545.3NoneNone
Pool1
POOL2. Average Tm 61.05 °C
ABCDEFGHIJKL
NameSequenceDirectionStartEndLengthProduct SizeTm%GCHairpin TmPair Dimer TmSelf Dimer Tm
SARSCoV_2000_02_LEFTAGGCCGCTATAACAATACTAGATGGAforward1956198126192361.342.3NoneNoneNone
SARSCoV_2000_02_RIGHTCAGCGATCTTTTGTTCAACTTGCTreverse3855387824192360.841.7NoneNoneNone
SARSCoV_2000_04_LEFTTCAACATGCCAATTTAGATTCTTGCAforward5473549826192960.334.6None8.1None
SARSCoV_2000_04_RIGHTGCTGAAATCGGGGCCATTTGTAreverse7380740122192961.550None8.14.4
SARSCoV_2000_06_LEFTGCTGCTGAATGTACAATTTTTAAAGATGCforward9011903929200361.134.5NoneNoneNone
SARSCoV_2000_06_RIGHTAACCAGTGGTGTGTACCCTTGAreverse109921101322200361.55047None17.6
SARSCoV_2000_08_LEFTTCACCTAATTTAGCATGGCCTCTTforward126201264324195660.141.7NoneNone3.3
SARSCoV_2000_08_RIGHTCAGGGTCAGCAGCATACACAAGreverse145541457522195661.554.5NoneNoneNone
SARSCoV_2000_10_LEFTTGCATACGTAGACCATTCTTATGTTGTforward162911631727198560.83732.8None0.1
SARSCoV_2000_10_RIGHTGCTTCTTCGCGGGTGATAAACAreverse182541827522198561.550NoneNone6.1
SARSCoV_2000_12_LEFTGGACTACAAAAGAGATGCTCCAGCforward198781990124192061.55042.511.2None
SARSCoV_2000_12_RIGHTACCTCTTAGTACCATTGGTCCCAreverse217752179723192060.547.837.111.212.7
SARSCoV_2000_14_LEFTGCTGAACATGTCAACAACTCATATGAforward235192354426197360.138.535.2None5.1
SARSCoV_2000_14_RIGHTTGCAGTAGCGCGAACAAAATCTreverse254702549122197361.445.546.2None12.1
SARSCoV_2000_16_LEFTTCTTATTACAAATTGGGAGCTTCGCAforward270512707626199561.338.537.6NoneNone
SARSCoV_2000_16_RIGHTGCTTCTTAGAAGCCTCAGCAGCreverse290242904522199561.654.543.6None30.4
Pool2.

PRIMER STOCKS (100 micromolar (µM) )
If you have ordered each primer independently and need to generate primer pool stocks: add 5 µL of each primer from Pool 1 to a 1.5 mL Eppendorf labeled “Pool 1 (100µM)” and each primer from Pool 2 to a 1.5 mL Eppendorf labelled “Pool 2 (100µM)”. These are your 100 micromolar (µM) stocks of each primer pool.


Note
Primers should be diluted and pooled in the mastermix cabinet which should be cleaned with decontamination wipes and UV sterilised before and after use.

WORKING PRIMERS (10 micromolar (µM) )
Dilute the primer stocks 1:10 in molecular grade water, to generate 10µM primer working stocks. It is recommend that multiple aliquots of each primer pool are made to in case of degradation or contamination.
Note
Primers need to be used at a final concentration of 0.015 micromolar (µM) per primer.


POOLING OF PRIMERS
Label two 1.5 mL Eppendorf tubes, one as POOL1 and the another as POOL2.


Add 10 µL of each of the primers of set 1 to the Eppendorf tube labelled POOL1, final concentration will be 10 micromolar (µM) each

Add 10 µL of each of the primers of set 2 to the Eppendorf tube labelled POOL2, final concentration will be 10 micromolar (µM) each

Multiplex PCR
In the PCR hood set up the multiplex mastermix reaction as follows in 2 0.2mL PCR tubes. We use the
KAPA Taq HotStartMerck MilliporeSigma (Sigma-Aldrich)Catalog #KK1510

Component Pool 1 Pool 2 Final Concentration

5X Kapa HotStart Buffer 2.5 µL 2.5 µL 1 X
25 mM MgCl2 0.75 µL 0.75 µL 1.5 millimolar (mM)
10 mM dNTPs 0.25 µL 0.25 µL 0.2 millimolar (mM) each
Primer Pool 1 or 2 (10µM ea) 0.6 µL 0.6 µL 0.5 micromolar (µM)
Kapa Taq HotStart Polymerase 0.1 µL 0.1 µL 0.5 U
Nuclease-free water 5.8 µL 5.8 µL

Final mastermix volume 10.0 µL 10.0 µL

Note
A PCR mastermix for each pool should be made up in the mastermix cabinet and aliquoted into PCR strip tubes. Tubes should be wiped down when entering and leaving the mastermix cabinet.

In the extraction and sample addition cabinet add 2.5 µL cDNA to each tube and mix well by pipetting.
The final volume will be 12.5 µL
Note
The extraction and sample addition cabinet should should be cleaned with decontamination wipes and UV sterilised before and after use.


Pulse centrifuge the tubes to collect the contents at the bottom of the tube.
Set-up the following program on the thermal cycler:

Step Temperature Time Cycles

Heat Activation 98 °C 00:00:30 1
Denaturation 95 °C 00:00:15 25-35
Annealing and Extension 60 °C 00:05:00 25-35
Hold 4 °C Indefinite 1
Note
Cycle number should be 25 for Ct 18-21 up to a maximum of 35 cycles for Ct 35. We typically use 30 cycles.


Note
It is advisable to check each PCR amplicon by electrophoresis (1% agarose). MORE INFO

Expected result
Final concentrations of PCR products can range from ~20- 150ng/ul.



5m 45s
Pooling and PCR quantification
Amplicon quantification to make an equimolar mixture.


Note
At this stage, care should be taken with amplified PCR products. Only open tubes in a designated post-PCR workspace with equipment that is separate from areas where primers and mastermixes are handled.

Put 1 µL of each pool in a Nanodrop or similar spectometer and quantify the DNA concentration.
Label a 1.5 mL Eppendorf tube for each sample and make a equimolar mix with the two pools.
Calculate to achieve a final concentration of 50 ng/ul

Quantify DNA using a Qubit or other method.
Quantification using Nanodrop is not recommended for a good estimation of the final pool.

Note
Alternatively, these amplicons can also be used for Illumina sequencing, such as found here: x.doi.org/10.17504/protocols.io.betejeje

We have found that performing an Ampure XP bead clean up at this stage does not improve performance. Therefore, it is not necessary to clean up the PCR reaction at this step.

Protocol
Protocol
CREATED BY
Nikki Freed



Prepare a mastermix of Qubit™ working solution for the required number of samples and standards. The Qubit dsDNA kit requires 2 standards for calibration (see note below).


Per sample:

Qubit® dsDNA HS Reagent 1 µL
Qubit® dsDNA HS Buffer 199 µL

Note
If you have already performed a calibration on the Qubit machine for the selected assay you can use the previous calibration stored on the machine. We recommend performing a new calibration for every sample batch but a same-day calibration would be fine to use for multiple batches.

To avoid any cross-contamination, we recommend that you remove the total amount of working solution required for your samples and standards from the working solution bottle and then add the required volume to the appropriate tubes instead of pipetting directly from the bottle to each tube.

Label the tube lids. Do not label the side of the tube as this could interfere with the sample reading.

Note
Use only thin-wall, clear, 0.5mL PCR tubes. Acceptable tubes include Qubit™ assay tubes (Cat. No. Q32856)


Aliquot Qubit™ working solution to each tube:
  • standard tubes requires 190µL of Qubit™ working solution
  • sample tubes require anywhere from 180–199µL (depending how much sample you wish to add).

The final volume in each tube must be 200µL once sample/standard has been added.
Add 10µL of standard to the appropriate tube.
Add 1–20µL of each user sample to the appropriate tube.


Note
If you are adding 1–2µL of sample, use a P-2 pipette for best results.

Mix each tube vigorously by vortexing for 3–5 seconds.
Allow all tubes to incubate at room temperature for 2 minutes, then proceed to “Read standards and samples”.
On the Home screen of the Qubit™ 3 Fluorometer, press DNA, then select 1X dsDNA HS as the assay type. The Read standards screen is displayed. Press Read Standards to proceed.

Note
If you have already performed a calibration for the selected assay, the instrument prompts you to choose between reading new standards and running samples using the previous calibration. If you want to use the previous calibration, skip to step 12. Otherwise, continue with step 9.

Insert the tube containing Standard #1 into the sample chamber, close the lid, then press Read standard. When the reading is complete (~3 seconds), remove Standard #1.
Insert the tube containing Standard #2 into the sample chamber, close the lid, then press Read standard. When the reading is complete, remove Standard #2.
The instrument displays the results on the Read standard screen. For information on interpreting the calibration results, refer to the Qubit™ Fluorometer User Guide, available for download at thermofisher.com/qubit.
Press Run samples.
On the assay screen, select the sample volume and units:
  • Press the + or – buttons on the wheel, or anywhere on the wheel itself, to select the sample volume added to the assay tube (from 1–20µL).
  • From the unit dropdown menu, select the units for the output sample concentration (in this case choose ng/µL).
Insert a sample tube into the sample chamber, close the lid, then press Read tube. When the reading is complete (~3 seconds), remove the sample tube.
The top value (in large font) is the concentration of the original sample and the bottom value is the dilution concentration. For information on interpreting the sample results, refer to the Qubit™ Fluorometer User Guide.
Repeat step 14 until all samples have been read.
Carefully record all results and store run file from the Qubit on a memory stick.
All negative controls should ideally be ‘too low’ to read on the Qubit machine, but MUST be < 1ng per ul. If your negative controls >1ng per ul, considerable contamination has occurred and you must redo previous steps.
Normalisation
Label a 0.2 mL PCR tube for each sample.


Adjust the amount of DNA in the tube to be 100 ng total per sample in 7.5 µL molecular grade water.

Note
For example if your PCR reaction is at least 100 ng/µl add 1ul of the PCR reaction to 6.5ul of molecular grade water. Use 7.5ul of the negative control, even if there is no detectable DNA in the PCR reaction.

Tagmentation
7m
Nextera XT DNA Library Preparation KitIllumina, Inc.Catalog #FC-131-1024 WWe have reduced the amount of reagents used per reaction.

Label a 1.5 mL Eppendorf tube for each sample and add in this order:
Component Volume

  1. Tagment DNA buffer (TD) 3.75 µL
  2. cDNA 2 ng/µl 3 µL
Pipette 10 times to mix

Add Amplicon Tagment Mix 0.5 µL and pipette 10 times to mix
Centrifuge at 280 x g, 20°C, 00:01:00

Incubate in thermal cycler
55 °C for 00:10:00
10 °C indefenitly
10m
Add 2 µL of Neutralize Tagment Buffer (NT).
Pipette 10 times to mix
Centrifuge at 280 x g, 20°C, 00:01:00

Incubate at Room temperature for 00:05:00 0 °C

5m
Preserve the samples at 4-8 °C until use.

Indexing
30m
La siguiente reacción requiere de la enzima polimerasa 2x Ampigene HS Taq Mix Catalog # ENZ-NUC101-0200 y de los sets de Nextera XT. Cada set contiene 96 combinaciones de TAGs con esto podemos alcanzar 384 muestras usando los Nextera XT Index Kit v2 (Sets A,B,C y D) Catalog # 20027213;20027214;20027215;20027216.



A cada tubo de reaccion agregar:
Component Volume
Nuclease-free water 10 µL
2x Ampigene HS Taq Mix. 10 µL
Nextera XT index i5 1 µL
Nextera XT index i7 1 µL
ADN Tagmentado 3 µL
Final volume 25 µL
Centrifuge at 280 x g, 20°C, 00:01:00
1m
Set-up the following program on the thermal cycler:

Cover 100 °C

Step Temperature Time Cycles

Heat Activation 72 °C 00:03:00 1
Denaturation 95 °C 00:00:30 1
95 °C 00:00:10
Annealing and Extension 55 °C 00:00:30 14
72 °C 00:00:30
Hold 4 °C Indefinite 1
4m 40s

Purificación final y pooling
Al volumen que se tiene en el tubo agregar 0.8X de perlas magnéticas Ampure XP.

Mezclar y spin-down.

Llevar al magneto hasta formar el pellet y desechar el sobrenadante.

Agregar 150 uL de etanol 80% en posición contraria al pellet. Esperar 30 segundos.
Desechar el etanol.

Retirar el exceso de etanol y secar las perlas por 5 min.

Resuspender las perlas en 26 uL de Agua libre de nucleasas.
Mix y spin down. Incubar por 5 min a TA.

Llevar al magneto hasta formar el pellet y transferir 25 uL del sobrenadante a un nuevo tubo previamente etiquetado.

Cuantificar 2 uL por Qubit HS y analizar los tamaños mediante electroforesis en gel de agarosa al 1.0%.
Secuenciacion de bibliotecas en plataforma IIlumina Miniseq
A partir de la concentración en ng/uL determinada por Qubit y obtenido el tamaño aproximado del fragmento, llevar cada una de las librerias a una concetracion de 4 nM.
Transferir 5 uL de cada librerías a 4 nM aun tubo previamente etiquetado para obtener el pool final.
Seguir el protocolo Library Denaturing and miniseq Sample Loading del kit