Icon indicating open access to content
QR code linking to this content
Protocol CitationGert-Jan Hendriks, Daniel Ramsköld, Anton Larsson, Juliane Mayr, Christoph Ziegenhain, Leonard Hartmanis, rickard.sandberg , Michael Hagemann-Jensen 2023. NASC-seq2 Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.6qpvr43nogmk/v1
Manuscript citation:
Daniel Ramsköld, Gert-Jan Hendriks, Anton J. M. Larsson, Juliane V. Mayr, Christoph Ziegenhain, Michael Hagemann-Jensen, Leonard Hartmanis, Rickard Sandberg (2024) Single-cell new RNA sequencing reveals principles of transcription at the resolution of individual bursts.Nature Cell Biology doi: 10.1038/s41556-024-01486-9
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 21, 2022
Last Modified: May 18, 2026
Protocol  Integer ID: 73034
Keywords: seq2 protocol insights into transcriptional bursting kinetic, transcriptional bursting kinetic, analyses of static rna count, static rna count, time nascent rna imaging, rna in cell, rna, cell profiling, single cell, bursting dynamic, cell, seq2 protocol insight, seq2, nasc
Funders Acknowledgements:
GJH - Human Frontier Science Program
Grant ID: LT000155/2017-L
CZ - European Molecular Biology Organization
Grant ID: ALTF 673-2017
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Insights into transcriptional bursting kinetics and regulation have emerged from real-time nascent RNA imaging and analyses of static RNA counts over cells. Here, we developed sensitive single-cell profiling of newly transcribed (or new) RNA in cells (NASC-seq2) that can easily be applied to tens of thousands of single cells to help shed new light on bursting dynamics and coordination.
Image Attribution
Illustration by Beata Edyta Mierzwa (www.BeataScienceArt.com, social media: @beatascienceart)
Materials
EQUIPMENT

  • Single-channel and multichannel pipettes
  • Contact liquid handler for sample transfer and Vapor-Lock dispensing (Such as Agilent Bravo)
  • Nanodispenser (such as Dispendix I.DOT, I.DOT Mini or Formulatrix Mantis)
  • Plate centrifuge
  • Tube centrifuge
  • Fluorescence plate reader (compatible with Quantifluor dsDNA dye or similar)
  • PE200 Sequencing (such as MGI G400 or Illumina NovaSeq)
  • Magnetic Rack (384-well plate)
  • Magnetic Rack (1.5ml Eppendorf tubes)
  • 384-well compatible thermal cyclers

MATERIALS

General Protocol

Armadillo PCR Plate, 384-well, clear, clear wellsThermo FisherCatalog #AB2384
Vapor-LockQiagenCatalog #981611
Adhesive sealing sheetsThermo ScientificCatalog #AB0558
Filter Tips
dimethylsulfoxide (DMSO)Merck MilliporeSigma (Sigma-Aldrich)
Triton X-100Merck MilliporeSigma (Sigma-Aldrich)Catalog #T8787-50ML
UltraPure DNase/RNase-Free Distilled WaterThermo Fisher ScientificCatalog #10977023
DNA LoBind TubesEppendorfCatalog ##022431021
4-thiouridine (4sU)Merck MilliporeSigma (Sigma-Aldrich)Catalog #T4509
Tris-HCL (pH 8.4 1M)Merck MilliporeSigma (Sigma-Aldrich)
Iodoacetamide (single-use vial 56mg)Merck MilliporeSigma (Sigma-Aldrich)Catalog #A3221
Tris-HCl, pH 8.0 (UltraPure)Thermo Fisher ScientificCatalog #15568025
Sodium Chloride (5M)Invitrogen - Thermo FisherCatalog #AM9760G
GTP (Tris buffered solution 100mM)Thermo ScientificCatalog #R1461
Magnesium Chloride (1M Solution)Invitrogen - Thermo FisherCatalog #AM9530G
Poly Ethylene Glycol (PEG) 8000Merck MilliporeSigma (Sigma-Aldrich)Catalog #89510-250G-F
Dithiothreitol (DTT)Thermo Fisher ScientificCatalog #707265ML
Recombinant RNAse InhibitorTakara Bio Inc.Catalog #2313A
Maxima H Minus Reverse Transcriptase (200 U/µL)Thermo FisherCatalog #EP0751
KAPA HiFi Hotstart PCR kitRocheCatalog #KK2502
dNTP Set 100 mM SolutionsThermo Fisher ScientificCatalog #R0182
QuantiFluor(R) dsDNA SystemPromegaCatalog #E2670
Agilent High Sensitivity DNA Kit Agilent TechnologiesCatalog #5067-4626
Tris-HCl pH 7.5
Nextera XT sample prep kit, 96 samples Illumina, Inc.Catalog #FC-131- 1096
NN-DimethylformamideMerck MilliporeSigma (Sigma-Aldrich)Catalog #D4551
SDS, 10% SolutionLife TechnologiesCatalog #AM9822
Phusion High-Fidelity DNA Polymerase (2 U/µL)Thermo FisherCatalog #F530L

When using AmpureXP beads

Agencourt AMPure XPBeckman CoulterCatalog #A63880

When using DIY beads

Sera-Mag Speed BeadsGE HealthcareCatalog #65152105050250
Sodium AzideMerck MilliporeSigma (Sigma-Aldrich)Catalog #S2002-100G
IGEPAL-CA630Merck MilliporeSigma (Sigma-Aldrich)Catalog #I3021 SIGMA-ALDRICH
EDTA (0.5 M), pH 8.0Life TechnologiesCatalog #AM9260G

PRIMERS

All primers are the same as used in Smart-seq3 and were HPLC purified, with the TSO below being RNase-free HPLC purified.

  • Smartseq3_OligodT30VN
/5Biosg/ACGAGCATCAGCAGCATACGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
  • Smartseq3_N8_TSO
/5Biosg/AGAGACAGATTGCGCAATGNNNNNNNNrGrGrG
  • Fwd_PCR_primer
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAA*T*G
  • Rev_PCR_primer
ACGAGCATCAGCAGCATAC*G*A
Citation
Hagemann-Jensen M, Ziegenhain C, Chen P, Ramsköld D, Hendriks GJ, Larsson AJM, Faridani OR, Sandberg R (2020). Single-cell RNA counting at allele and isoform resolution using Smart-seq3.
LINK

OPTIONAL
  • Molecular Spike synthetic RNAs that were in vitro transcribed in the presence of 4sUTP (NU-1156S, Jena Bioscience).
Citation
Christoph Ziegenhain, Gert-Jan Hendriks, Michael Hagemann-Jensen, Rickard Sandberg (2022). Molecular spikes: a gold standard for single-cell RNA counting. Nature Methods.
LINK

Prepare lysis plates
Using an automated pipetting platform or multichannel pipette, dispense 3uL of Vapor-Lock (Qiagen) to each well of a 384-well plate.

Note:
Do not use a non-contact dispenser (such as Dispendix IDOT or Formulatrix Mantis) for this step as the Vapor-Lock may severely damage the dispenser. We do this using an Agilent Bravo platform.

Prepare the following lysis buffer on ice.



ReagentFinal concentration1 reaction384-well plate
Recombinant RNAse Inhibitor (40 U/uL)2.5 u/uL0.0188 uL8.66 uL
4sU containing spUMI pool (OPTIONAL, 0.01 ng/uL)0.04 pg/uL0.0012 uL0.553 uL
Triton-X100 (2 %)0.1%0.015 uL6.91 uL
Nuclease-free water-0.265 uL122.1 uL
Total0.3 uL138.2 uL

On ice

Use a nanodispenser to distribute 0.3 uL of freshly prepared lysis buffer to each well of vapor-lock containing 384-well PCR plate.

0.3 µL Lysis buffer
On ice


Spin down at >3,000 G for 10 seconds.

3000 x g, 00:00:10

10s
Optional: Store lysis plate.

If not immediately continuing with the next step, prepared lysis plates can be sealed with aluminium seals and stored at -80°C.
Cell culture and FACS sorting
Grow cells in the presence of 50 μM 4sU. It can be helpful to collect untreated cells as a control.
Note
  • 4sU is light-sensitive, and direct light (i.e. light in the cell culture hood, etc) should be reduced to a minimum.
  • Do not refreeze leftovers from 4sU aliquot.
  • Labeling times can vary for different celltypes and biological applications, but in general, short labeling times (i.e. less than 30 minutes) may result in poor separation of new and old molecules. Depending on your downstream analysis, this may affect your results.

Stop the labeling by transferring your cells to 15-ml falcon tubes on ice and wash them with cold PBS.
On ice

Distribute single cells into each well of the lysis plate by FACS sorting.
Spin down and seal the plates with aluminium seals and store them at -80°C.
Alkylation
Prepare the alkylation mix at room temperature.


ReagentFinal concentration1 reaction384-well plate
Tris-HCL (pH 8.4, 1 M)50 mM0.03 uL13.8 uL
DMSO (100 %)45 %0.24 uL110.6 uL
IAA in DMSO (200 mM)10 mM0.03 uL13.8 uL
Total0.3 uL138.2 uL
Please note that the calculations in this mix are calculated to the final volume in the alkylation reaction (i.e. 0.6uL). The DMSO final concentration listed above also accounts for the DMSO that is added with the IAA.
Room temperature


Note
To avoid problems with iodocatamide stability and variability of alkylating potential, we use single-use vials (Sigma A3221-10VL) of iodoacetamide that are dissolved in DMSO at 200mM right before they are used to prepare the alkylation mix above and the remainder is discarded.

Safety information
Iodoacetamide should be handled in a fume hood and in accordence with local environmental health and safety regulations.

Using a nanodispenser, distribute 0.3 uL of freshly prepared alkylation mix to all wells of the 384-well plate containing cells and lysis-buffer.
Spin the 384-well plate down at >3,000 x G for 10 seconds.
Incubate the plate at 50C for 15 minutes. While this is running, prepare the quenching mix (see the next section).

50 °C 15 minutes

Quenching and Denaturation
Prepare the quencing mix on ice.


ReagentFinal concentration1 reaction384-well plate
DTT (1 M in H2O)35 mM0.035 uL16.13 uL
dNTPs (10 mM each)0.5 mM each0.2 uL92.16 uL
Oligo-dT (100 uM)0.6 uM0.024 uL11.06 uL
Recombinant RNAse Inhibitor (40 U/uL)0.4 u/uL0.04 uL18.43 uL
Nuclease-free water-0.101 uL46.54 uL
Total0.4 uL184.32
Note that the dNTPs, oligo-dT and RRI concentrations above are calculated to the final volume in the Reverse Transcription mix (4uL) and not the Quenching mix (1uL).

Using a nanodispenser, distribute 0.4 uL of freshly prepared quenching and denuturation mix to all wells of the 384-well plate.
Spin the 384-well plate down at >3,000 x G for 10 seconds
Incubate the plate for 5 minutes at room temperature, followed by 10 minutes at 72C and a final hold at 4C. While this is running, prepare the Reverse Transcription mix (see the next section)
Reverse Transcription
Prepare the Reverse Transcription mix as below

ReagentFinal concentration1 reaction384-well plate
Tris-HCL (1 M, pH 8.0) 25 mM0,1 uL46.08 uL
NaCl (1 M)35 mM0,14 uL64.51 uL
GTP (100 mM)1 mM0,04 uL18.43 uL
MgCl2 (1 M)2.5 mM0.01 uL4.61 uL
PEG (40 %)5 %0.5 uL230.4 uL
DTT (1 M)2 mM + carry-over from quenching and denaturation mix0.008 uL3.69 uL
Recombinant RNAse Inhibitor (40 U/uL)0.4 U/uL + carry-over from lysis as well as quenching and denaturation mix0.04 uL18.43 uL
Template Switching Oligo (1 mM)2 uM0.008 uL3.69 uL
Maxima H-minus RT enzyme (200 U/uL)2 U/uL0.04 uL18.43 uL
H2O -2.11 uL974.13 uL
Total3 uL1382.4 uL

Dispense 3 uL of the freshly prepared Reverse Transcription mix to all wells of the 384-well plate.
Spin the 384-well plate down at >3,000 x G for 10 seconds
Place the plate in the thermal cycler and start the Reverse Transcription program
Preamplification PCR
For the remainer of the protocol we are using standard Smart-seq3 reaction conditions.
Citation
Hagemann-Jensen M, Ziegenhain C, Chen P, Ramsköld D, Hendriks GJ, Larsson AJM, Faridani OR, Sandberg R (2020). Single-cell RNA counting at allele and isoform resolution using Smart-seq3. Nature biotechnology.
LINK
A detailed description of the Smart-seq3 protocol is also available on protocols.io.
Protocol
Smart-seq3 Protocol
CREATED BY
Michael Hagemann-Jensen

For convenience, the preamplification PCR protocol is also included below.
Prepare the preamplification PCR mix as below


ReagentFinal concentration1 reaction384-well plate
Kapa HiFi HotStart buffer (5 X)1 X2.0 uL820 uL
dNTPs (25 mM/each)0.3 mM/each0.12 uL49.2 uL
MgCl2 (100 mM)0.5 mM0.05 uL20.5 uL
Fwd Primer (100 uM)0.5 uM0.05 uL20.5 uL
Rev Primer (100 uM)0.1 uM0.01 uL4.1 uL
Polymerase (1 U/uL)0.02 U/uL0.2 uL82 uL
Nuclease Free Water-3.57 uL1463.7 uL
Total6 uL2460 uL
Preamplification PCR mix from Hagemann-Jensen et al.

Dispense 6 uL of the freshly prepared preamplification PCR mix to all wells of the 384-well plate.
Spin the 384-well plate down at >3,000 x G for 10 seconds
Place the plate in the thermal cycler and start the following PCR program

ABCD
StepTemperatureTimeCycles
Initial denaturation98 °C3 min1x
Denaturation98 °C20 sec20-25x
Annealing65°C30 sec
Elongation72 °C4 min
Final Elongation72 °C5 min1x
Hold4 °CHold



Purification, QC and Tagmentation
For details on the purification of the amplified cDNA, the quality control and the tagmentation to produce the final sequencing libraries, please refer to the Smart-seq3 protocols.io.

Protocol
Smart-seq3 Protocol
CREATED BY
Michael Hagemann-Jensen

Sequencing and data analysis
We have chosen to perform relatively long short-read sequencing with most data produced for NASC-seq2 being sequenced PE200. We highly recommend this as it will increase your ability to call individual molecules as either new (labeled) or old (unlabeled).

For details on data processing and analysis, please see the lab github:


Citations
Christoph Ziegenhain, Gert-Jan Hendriks, Michael Hagemann-Jensen, Rickard Sandberg. Molecular spikes: a gold standard for single-cell RNA counting
https://doi.org/10.1038/s41592-022-01446-x