Nov 04, 2025

Nanopore Sequencing of Environmental Microbial Metagenomes and Metatranscriptomes Using the Native Barcoding Kit 24 V14

  • 1Department of Biological Sciences and Centre for Deep Sea Research, University of Bergen
Icon indicating open access to content
QR code linking to this content
Protocol CitationThuc Trong Nguyen, Runar Stokke 2025. Nanopore Sequencing of Environmental Microbial Metagenomes and Metatranscriptomes Using the Native Barcoding Kit 24 V14. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpzz9plzp/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 31, 2024
Last Modified: November 04, 2025
Protocol  Integer ID: 101013
Keywords: Nanopore sequencing, Direct cDNA sequencing, Native barcoding, Metagenomic, Metatranscriptomic, Biofilm, nanopore sequencing of environmental microbial metagenome, nanopore sequencing, environmental microbial metagenome, streamlined workflow for nanopore, environmental biofilm metagenome, oxford nanopore technology, nanopore, studying microbial community, microbial communities in environment, read sequencing, rna extraction, barcode ligation, sequencing output, native barcoding kit 24 v14, metatranscriptome
Funders Acknowledgements:
Research council of Norway
Grant ID: 315427
Disclaimer
FOR RESEARCH PURPOSES ONLY; USE AT YOUR OWN RISK
This protocol is provided for informational purposes only and does not constitute legal, medical, clinical, or safety advice. Content added to protocols.io is not peer-reviewed and may not have undergone formal approval. The information in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action taken or omitted based on this protocol is solely at the user's own risk.
Abstract
This protocol presents a streamlined workflow for Nanopore sequencing of environmental biofilm metagenomes and metatranscriptomes using the Native Barcoding Kit 24 V14. It details the DNA/RNA extraction, rRNA depletion, polyadenylation, cDNA synthesis, barcoding, and library preparation steps, optimized for long-read sequencing. The workflow incorporates magnetic bead-based purification and barcode ligation to enable multiplexed sequencing on an Oxford Nanopore Technologies (ONT) platform. Designed to maximize DNA/cDNA yield, minimize purification losses, and ensure high-quality sequencing output, this method is well-suited for studying microbial communities in environments, including deep-sea hydrothermal vents and other extreme habitats.
Guidelines
Using the Native Barcoding Kit 24 V14

Key Considerations
  • Sample Quality: Ensure proper collection and storage of environmental samples to prevent degradation.
  • RNA Handling: Use RNase-free reagents and clean the workspace with RNase AWAY to avoid contamination.
  • Minimizing Sample Loss: Be mindful of purification steps, as RNA losses can be significant.
  • Bead-Based Purification: Magnetic bead clean-ups must be performed carefully to maximize yield.
  • Barcode Selection: Choose unique barcodes (NB01–24) for multiplexed sequencing.
  • Library Preparation: Follow ONT guidelines for adapter ligation and sequencing setup.
Materials
  • ZymoBIOMICS DNA/RNA Miniprep Kit R2002 (Zymo Research)
  • DNase I E1010 (Zymo Research)
  • AMPure XP Beads (Beckman Coulter)
  • HighPrep RNA Elite RC-90005 (MagBio)
  • Pan-Prokaryote riboPOOL Kit (siTOOLs Biotech)
  • Qubit RNA HS Assay Kit (Thermo Fisher)
  • Qubit RNA IQ Assay Kit (Thermo Fisher)
  • dNTP Mix (10 mM each) R0193 (Thermo Fisher)
  • RNase Cocktail Enzyme Mix AM2286 (Thermo Fisher)
  • RNaseOUT Recombinant Ribonuclease Inhibitor 10777019 (Thermo Fisher)
  • ATP Solution (10 mM) PV3227 (Thermo Fisher)
  • Maxima Reverse Transcriptase (200 U/μL) EP0741 (Thermo Fisher)
  • UltraPure BSA (50 mg/mL) (Thermo Fisher)
  • VN Primer (2 µM) (/5phos/ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN)
  • Strand-switching Primer (10 µM) (TTTCTGTTGGTGCTGATATTGCTmGmGmG)
  • PR2 Primer (10 µM) (/5Phos/TTTCTGTTGGTGCTGATATTGC)
  • E. coli Poly(A) Polymerase M0276S (New England Biolabs)
  • Blunt/TA Ligase Master Mix M0367S (New England Biolabs)
  • NEBNext Quick Ligation Reaction Buffer B6058S (New England Biolabs)
  • NEBNext Companion Module for Oxford Nanopore Technologies Ligation Sequencing E7180S (New England Biolabs)
  • Native Barcoding Kit 24 V14 (SQK-NBD114.24) (Oxford Nanopore Technologies)
  • ONT Flow Cell R10.4.1 (Oxford Nanopore Technologies)
Safety warnings
The loss of RNA from extraction to cDNA synthesis is very high (~98.11%). Start with ≥1000 ng of total RNA per sample to retain enough cDNA for sequencing.

Safety
  • Use PPE when handling chemicals and biological samples.
  • Follow the latest version of protocols on The Nanopore Community for the best library prep and sequencing results.
Before start
Clean the workbench and all the equipment with RNase AWAY before starting any work.
DNA/RNA extraction using ZymoBIOMICS DNA/RNA Miniprep Kit
33m 30s
In a ZR BashingBead Lysis Tube (0.1 & 0.5 mm), add up to 250 mg of biofilm sample and 750 µL DNA/RNA Shield . Ensuring a total volume of approximately 1000 µL per tube. 1000 µL

5m
Close the tube caps tightly. Homogenize the sample using a Homogenizer Bead Mill or FastPrep-24 at a speed of 6 m/s for two rounds, each lasting 1 minute. Allow the sample tubes to cool On ice for 5 minutes between rounds.

10m
Centrifuge at 16000 x g, 00:00:30

30s
Carefully transfer the entire supernatant into a 1.5 mL Eppendorf DNA LoBind tube, ensuring that the pellet remains undisturbed.
2m
Add an equal volume of DNA/RNA Lysis Buffer to the supernatant at a 1:1 ratio (e.g., 400 μL of Lysis Buffer for 400 μL of sample). Mix thoroughly by vortexing, then briefly spin down.
2m
Transfer the sample into a Spin-Away Filter (yellow) placed in a Collection Tube. Centrifuge at 16000 x g, 00:00:30 . Carefully transfer the flow-through to a clean 1.5 mL Eppendorf DNA LoBind tube for RNA collection, and retain the filter for DNA purification.

30s
Repeat the previous step until the entire mixture from Step 5 has been filtered.

10m
Step case

Metatranscriptomic sequencing
153 steps

RNA extraction
55m 30s
Add an equal volume of absolute ethanol to the flow-through and mix thoroughly by pipetting.
3m
Transfer the mix into a Zymo-Spin IIICG Column (green) placed in a Collection Tube. Centrifuge at 16000 rpm, 00:00:30 . Discard the flow-through. If necessary, reload the column and repeat the centrifugation.
30s
DNase I Treatment in-column

Add 400 µL DNA/RNA Wash Buffer to the column. Centrifuge at 16000 x g, 00:00:30 . Discard the flow-through

30s
Prepare the following mix in a clean Eppendorf tube, adjusting the quantities based on the number of columns you use.
Reaction mixVolume
DNase I reconstituted (1U/uL)5 μL
DNA digestion buffer75 μL
Total volume per reaction80 μL
Mix by gentle inversion, then briefly spin down. Do not vortex.

2m
Add 80 µL DNase I reaction Mix (from step 9.2) directly into the column matrix. Incubate at Room temperature for 00:15:00

15m
Add 400 µL DNA/RNA Prep Buffer to the column. Centrifuge at 16000 rpm, 00:00:30 . Discard the flow-through

30s
Add 700 µL DNA/RNA Wash Buffer to the column. Centrifuge at 16000 rpm, 00:00:30 . Discard the flow-through

30s
Add 400 µL DNA/RNA Wash Buffer to the column. Centrifuge at 16000 x g, 00:02:00 . Carefully transfer the column into a new nuclease-free Eppendorf tube.

2m
Add 100 µL ZymoBIOMIC DNase/Rnase-Free Water directly to the column matrix. Incubate at Room temperature for 00:05:00 . Centrifuge at 16000 x g, 00:00:30 to elute RNA from the column.
Note
Alternatively, for highly concentrated RNA, use ≥50 mL elution



5m 30s
Place a Zymo-Spin III-HRC Filter in a Collection Tube. Add 600 µL ZymoBIOMICS HRC Prep Solution . Centrifuge at 8000 x g, 00:03:00 .

3m
Transfer the eluted RNA from Step 13 into a prepared Zymo-Spin III-HRC Filter (Step 14) placed in a nuclease-free Eppendorf DNA LoBind tube. Centrifuge at 16000 x g, 00:03:00 .

Note
The filtered RNA can be used immediately or stored frozen at -80 °C .
Quantify 1 µL of the eluted sample using Qubit fluorometer (Qubit RNA HS).


3m
Total RNA Purification using HighPrep RNA Elite Beads
49m 30s
Thoroughly shake the HighPrep RNA Elite reagent before use.
Note
Allow the HighPrep RNA Elite reagent to reach Room temperature for at least 00:30:00 before use.



1m
Transfer the total RNA sample into a clean 1.5 mL Eppendorf tube.

1m
Add the appropriate volume of HighPrep RNA Elite reagent based on the volume of your total RNA sample.
Volume of RNA (μL)Volume of HighPrep RNA Elite 1.8X (μL)
1018
5090
100180

2m
Mix thoroughly by pipetting up and down 6-8 times.
1m
Incubate on a Hula mixer for 00:05:00 at Room temperature .

5m
Place the mixture on a magnetic separation device for 00:15:00 or until the solution becomes clear.

15m
While keeping the Eppendorf tube on the magnet, carefully pipette off and discard the supernatant.
1m
With the tube on the magnet, add 200 µL 70% ethanol to the Eppendorf tube. Incubate atRoom temperature for 00:00:30

30s
While keeping the Eppendorf tube on the magnet, carefully pipette off and discard the supernatant.
Note
If the pellet is disturbed, allow the beads to settle again before removing the ethanol.

1m
Repeat steps 23-24 for three 70% ethanol washes.

5m
Dry the beads by incubating the Eppendorf tube on the magnetic separation device at Room temperature for up to 00:10:00 .
Note
Ensure that all traces of ethanol are completely removed. However, avoid overdrying the beads, as a cracked dry pellet may reduce the yield.



10m
Remove the tube from the magnetic separation device. Add 40 µL elution buffer (e.g., nuclease-free water) to the reaction tube and mix by pipetting up and down.

Note
Prewarming the nuclease-free water to 55 °C can help increase the yield.




1m
Incubate the tube on a Hula mixer for 00:02:00 atRoom temperature .

2m
Briefly spin down the tube. Place it back on the magnetic separation device and wait for 00:03:00 or until the beads have completely cleared from the solution.

3m
Transfer the eluate (cleared supernatant) to a clean 1.5 mL Eppendorf tube for storage or subsequent applications.
Note
Quantify1 µL of the eluted sample using Qubit fluorometer (Qubit RNA HS).


1m
rRNA depletion using riboPOOL Kit
59m 30s
Add the following reagent to a 1.5 mL Eppendorf tube

ReagentVolume
Hybridization Buffer (HB) 5 μL
Resuspended RP1 μL
RNA sample (containing 100ng - 5 ug of total RNA)14 μL
RNaseOUT™0.5 μL
Total20.5 μL

2m
Vortex thoroughly and briefly spin down.
30s
Incubate at 68 °C for 00:10:00 to denature RNA.

10m
Allow the sample to cool gradually from 68 °C to 37 °C for optimal hybridisation.
Note
To achieve this, turn off the heating block and allow the temperature to naturally decrease to 37°C. If using temperature-controlled ramping, cool down at a rate of 3°C per minute.


15m
Resuspend the streptavidin-coated magnetic beads (SMB) by carefully vortexing the tube at medium speed.
30s
Transfer90 µL of bead suspension per sample into a fresh tube.

Note
For batch washing of beads for multiple samples, aliquot the bead suspension into a single tube: use up to 540 µL for 6 samples or 1080 µL for 12 samples.


30s
Place the tube containing SMB beads on a magnetic rack and wait for 00:01:00 .

1m
Remove and discard the supernatant carefully.
1m
Add 80 µL of Depletion Buffer (DB) per sample (e.g., 480 µL for 6 samples and 960 µL for 12 samples). Agitate the tube well to fully resuspend the beads.

1m
Repeat Steps 37-39.
3m
Briefly centrifuge the tube containing 20.5 µL of hybridized riboPOOL and total RNA (from Step 34).

30s
Pipette80 µL of the prepared beads (from Step 40) into the tube containing hybridised riboPOOL-RNA solution. Agitate the tube thoroughly to ensure proper resuspension.
1m
Incubate the tube at37 °C for00:15:00 , followed by 50 °C for 00:05:00 in a thermal cycler.

20m
Briefly spin down to collect any droplets.
30s
Place on the magnet for00:02:00 . Then, carefully transfer the supernatant to a new 1.5 mL Eppendorf tube.

2m
Place the tube on the magnet for00:01:00 to remove any trace amounts of beads (optional). Carefully transfer the supernatant to a new tube.

Note
At this stage, the elution should primarily contain mRNA. The RNA concentration is expected to decrease by approximately 90% from the initial amount due to the depletion of rRNA from the total RNA sample.


1m
mRNA Purification using HighPrep RNA Elite
50m
Follow the same protocol to purify total RNA precisely (from Step 16 to Step 30). The volume of elution buffer (Step 27) can be adjusted to 30 µL to achieve a higher RNA concentration.

Note
Quantify1 µL of the eluted RNA using Qubit fluorometer (Qubit RNA HS)
Qualify1 µL of the eluted RNA using either Bioanalyzer RNA 6000 Pico Kit (Agilent) or Qubit fluorometer (Qubit RNA IQ)


Polyadenylating RNA with E. coli poly(A) polymerase
39m 30s
In a 1.5 mL Eppendorf tube, set up a 3’ polyadenylation reaction as follows

ReagentVolume
Non-polyadenylated RNA (from step 47)X μL (e.g., 10 μL)
10X E. coli Poly(A) Polymerase Reaction Buffer2 μL
ATP (10mM)2 μL
E. coli Poly(A) Polymerase1 μL
Nuclease-free water14.5 μL - X μL (e.g., 14.5 - 10 = 4.5 μL)
RNaseOUT™0.5 μL
Total20 μL
Gently agitate by pipetting up and down. Do not vortex.
2m
Incubate reaction at 37 °C for 00:10:00 .

10m
Stop the reaction by adding5 µL of50 millimolar (mM) EDTA (to achieve a final concentration of 10 millimolar (mM) EDTA ). The final reaction volume will be 25 µL .
30s
Add45 µL of resuspended HighPrep RNA Elite Beads to the reaction tube.

30s
Incubate on a Hula mixer for00:05:00 atRoom temperature

5m
Spin down the sample, then pellet it using a magnetic separation device. Keep the tube on the magnet, carefully pipette off and discard the supernatant.
5m
Keep the tube on the magnet and wash the beads with 200 µL of freshly prepared 70% ethanol. Gently rotate the tube 180° twice in the rack to ensure thorough washing of the pelleted beads. Carefully pipette off and discard the supernatant.
2m
Repeat Step 54 to perform a total of two washes.
2m
Briefly spin down the tube and place it back on the magnet. Carefully pipette off any residual ethanol. Allow the beads to dry for 00:00:30 , ensuring the pellet does not over-dry or crack.
30s
Remove the tube from the magnetic rack and resuspend the pellet in12 µL of nuclease-free water. IncubateOn ice for00:05:00 .

5m
Place the tube on the magnet until the beads pellet and the eluate becomes clear and colourless.
5m
Carefully remove and retain 12 µL of the eluate containing the 3′-polyadenylated RNA in a clean 1.5 mL Eppendorf tube.
Note
Quantify1 µL of the eluted sample using Qubit fluorometer (Qubit RNA HS)



2m
Reverse transcription and strand-switching
2h 4m
Prepare the following reaction in the 0.2 mL PCR tube:

ReagentVolume
RNA (100 ng Poly(A)+ RNA)7.5 μL
VN Primer diluted to 2 uM2.5 μL
10 mM dNTPs1 μL
Total11 μL

2m
Mix gently by flicking the tube, then briefly spin down.
30s
Incubate at 65 °C for 00:05:00 and then snap cool on a pre-chilled freezer block for00:01:00
6m
In a separate tube, mix the following:
ReagentVolume
5x RT Buffer4 μL
RNase OUT1 μL
Nuclease-free water1 μL
Strand-switching Primer diluted to 10 uL2 μL
Total8 μL

2m
Mix gently by flicking the tube, and spin down.
30s
Add 8 µL of the strand-switching reagents (prepared in Step 63) to the 11 µL of snap-cooled mRNA (from Step 62). Mix gently by flicking the tube, then briefly spin down.
1m
Incubate at 42 °C for 00:02:00 in the thermal cycler.

2m
Add 1 µL of Maxima H Minus Reverse Transcriptase, bringing the total volume to 20 µL .

Mix gently by flicking the tube, and spin down.
Incubate using the following protocol using a thermal cycler:

Cycle stepTemperatureTimeNo. of cycles
Reverse transcription and strand- switching42°C90 mins1
Heat inactivation85°C5 mins1
Hold4°C
1h 50m
RNA degradation and second-strand synthesis
1h 36m 30s
Add 1 µL of RNase Cocktail Enzyme Mix to the reverse transcription reaction (end product from Step 68).

1m
Incubate the reaction for 00:10:00 at 37 °C in the thermal cycler.
10m
Resuspend the AMPure XP beads (AXP) by vortexing thoroughly.
1m
Transfer the sample to a clean 1.5 mL Eppendorf DNA LoBind tube.
1m
Add 17 µL of resuspended AMPure XP beads (AXP) to the reaction and mix gently by flicking the tube.

1m
Incubate on a Hula mixer for 00:05:00 at Room temperature .

5m
Spin down the sample, then pellet it using a magnetic separation device until the supernatant is clear and colourless. Keep the tube on the magnetic device and carefully pipette off the supernatant.
5m
Keep the tubes on the magnetic device and wash the beads with200 µL of freshly prepared 80% ethanol, ensuring the pellet remains undisturbed. Carefully remove and discard the ethanol using a pipette.
Note
If the pellet is disturbed, allow the beads to re-pellet before removing the ethanol.


2m
Repeat Step 76 for a total of two washes.
2m
Spin down the tube and place it back on the magnetic device. Carefully pipette off any residual ethanol. Allow the beads to dry for approximately 00:00:30 , ensuring the pellet does not over-dry or crack.

30s
Remove the tube from the magnetic rack and resuspend the pellet in20 µL nuclease-free water.

1m
Incubate on a Hula mixer for 00:10:00 at Room temperature
10m
Briefly spin down the tube, then pellet the beads on the magnet until the eluate is clear and colourless, for at least 00:01:00

1m
Carefully remove and retain 20 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.
1m
Prepare the following reaction in a 0.2 mL thin-walled PCR tube:
ReagentVolume
2x LongAmp Taq Master Mix25 μl
PR2 Primer diluted to 10 μM2 μl
Reverse-transcribed sample from above (Step 82)20 μl
Nuclease-free water 3 μl
Total50 μl
Mix gently by flicking the tube
3m
Incubate using the following protocol in a thermal cycler:
Cycle stepTemperatureTimeNo. of cycles
Denaturation94 °C1 min1
Annealing50 °C1 min1
Extension65 °C15 mins1
Hold4 °C

20m
Resuspend the AMPure XP beads (AXP) by vortexing thoroughly.
1m
Transfer the sample (end product of Step 84) to a clean 1.5 mL Eppendorf DNA LoBind tube.
1m
Add 40 µL of resuspended AMPure XP beads (AXP) to the reaction and mix gently by flicking the tube.

1m
Incubate on a Hula mixer for 00:05:00 at Room temperature .

5m
Spin down the sample, then pellet it using a magnetic separation device until the supernatant is clear and colourless. Keep the tube on the magnetic device and carefully pipette off the supernatant.
5m
Keep the tubes on the magnetic device and wash the beads with200 µL of freshly prepared 80% ethanol, ensuring the pellet remains undisturbed. Carefully remove and discard the ethanol using a pipette.
Note
If the pellet is disturbed, allow the beads to re-pellet before removing the ethanol.


2m
Repeat Step 90 for a total of two washes.
2m
Spin down the tube and place it back on the magnetic device. Carefully pipette off any residual ethanol. Allow the beads to dry for approximately 00:00:30 , ensuring the pellet does not over-dry or crack.
1m
Remove the tube from the magnetic rack and resuspend the pellet in 21 µL nuclease-free water.
1m
Incubate on a Hula mixer for 00:10:00 at Room temperature .
10m
Briefly spin down the tube, then pellet the beads on the magnet until the eluate is clear and colourless, for at least 00:01:00 .
1m
Carefully remove and retain 21 µL of eluate in a clean 1.5 mL Eppendorf DNA LoBind tube.
Note
Quantify 1 µL of the eluted sample using Qubit fluorometer (Qubit DNA HS)


2m
cDNA repair and end-prep
34m 30s
Combine the following reagents in a 0.2 m PCR tube:
ReagentVolume
cDNA sample (Step 96)20 μl
Nuclease-free water30 μl
Ultra II End-prep reaction buffer7 μl
Ultra II End-prep enzyme mix3 μl
Total60 μl

Note
Ensure the reaction is thoroughly mixed by gently pipetting up and down, then briefly spin down.

3m
Using a thermal cycler, incubate at 20 °C for 00:05:00 , followed by 65 °C for 00:05:00 .
10m
Resuspend the AMPure XP Beads (AXP) by vortexing thoroughly.
1m
Transfer the sample (Step 98) to a clean 1.5 mL Eppendorf DNA LoBind tube.
1m
Add 60 µL of resuspended AMPure XP Beads (AXP) to the end-prep reaction (Step 100) and mix gently by flicking the tube.

2m
Incubate on a Hula mixer for 00:05:00 at Room temperature .

5m
Spin down the sample, then pellet it using a magnetic separation device until the supernatant is clear and colourless. Keep the tube on the magnetic device and carefully pipette off the supernatant.
5m
Keep the tubes on the magnetic device and wash the beads with200 µL of freshly prepared 80% ethanol, ensuring the pellet remains undisturbed. Carefully remove and discard the ethanol using a pipette.
Note
If the pellet is disturbed, allow the beads to re-pellet before removing the ethanol.


2m
Repeat Step 104 for a total of two washes
2m
Spin down the tube and place it back on the magnetic device. Carefully pipette off any residual ethanol. Allow the beads to dry for approximately 00:00:30 , ensuring the pellet does not over-dry or crack.
30s
Remove the tube from the magnetic rack and resuspend the pellet in 20 µL nuclease-free water. Incubate for 00:02:00 at room temperature.
2m
Pellet the beads on a magnetic rack until the eluate is clear and colourless, for at least 00:01:00
1m
Remove and retain 20 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.

Note
Quantify 1 µL of the eluted sample using a Qubit fluorometer (Qubit DNA HS)
At this point, cDNA can be stored at -20 °C for up to a month or at -80 °C for longer storage.


Native barcode ligation
1h 6m 30s
For each sample to be run together on the same flow cell, select a unique barcode from the Native Barcodes (NB01-24).
1m
In clean 0.2 mL PCR tubes, add the reagents in the following order per tube:
ReagentVolume
End-prepped DNA (from Step 109)7.5 μl
Native Barcode (NB01-24)2.5 μl
Blunt/TA Ligase Master Mix10 μl
Total20 μl

Note
Thoroughly mix the reaction by gently pipetting up and down, then briefly spin down.

2m
Incubate for 00:20:00 at Room temperature .
20m
Add the appropriate volume of EDTA to each tube, selecting the correct version based on the bottle cap colour. Mix thoroughly by pipetting, then briefly spin down.
EDTA cap colourVolume per tube
For clear cap EDTA2 μl
For blue cap EDTA4 μl
EDTA is added at this step to stop the reaction.

Note
The concentration of EDTA may vary depending on the version of your Nanopore reaction kit, as detailed below.

  • The EDTA vials with a clear cap contain 0.5M EDTA (old version concentration).
  • The EDTA vials with a blue cap contain 0.25M EDTA (new version concentration).

The new EDTA concentration is indicated in all batch numbers formatted as NBD1424.20.0001 and NBD1424.20.0002 (or higher). The old format was used in batch numbers following the format NBD1424.10.0001.

2m
Pool all the barcoded samples in a 1.5 mL Eppendorf DNA LoBind tube.
-Volume per sampleFor 6 samplesFor 12 samplesFor 24 samples
Total volume of preps using clear cap EDTA22 μl132 μl264 μl528 μl
Total volume of preps using blue cap EDTA24 μl144 μl288 μl576 μl
Note
IMPORTANT:
Ensure that the liquid volumes at the base of all tubes or wells in the plate are consistent before and after pooling to confirm that all liquid has been transferred correctly.

2m
Resuspend the AMPure XP Beads (AXP) by vortexing.
1m
Add AMPure XP Beads (AXP) to the pooled reaction at a 0.4X ratio and mix thoroughly by pipetting.
-Volume per sampleFor 6 samplesFor 12 samplesFor 24 samples
Volume of AXP for preps using clear cap EDTA9 μl53 μl106 μl211 μl
Volume of AXP for preps using blue cap EDTA10 μl58 μl115 μl230 μl

1m
Incubate on a Hula mixer for 00:10:00 at Room temperature
10m
Spin down the sample, then pellet it using a magnetic separation device until the supernatant is clear and colourless. Keep the tube on the magnetic device and carefully pipette off the supernatant.
5m
Keep the tubes on the magnetic device and wash the beads with700 µL of freshly prepared 80% ethanol, ensuring the pellet remains undisturbed. Carefully remove and discard the ethanol using a pipette.
Note
If the pellet is disturbed, allow the beads to re-pellet before removing the ethanol.


2m
Repeat Step 119 for a total of two washes
2m
Spin down the tube and place it back on the magnetic device. Carefully pipette off any residual ethanol. Allow the beads to dry for approximately 00:00:30 , ensuring the pellet does not over-dry or crack.
30s
Remove the tube from the magnetic rack and resuspend the pellet in 35 µL nuclease-free water by gently flicking.
1m
Incubate for 00:10:00 at 37 °C . Every 00:02:00 , gently flick the sample for 00:00:10 to promote DNA elution.
10m
Pellet the beads on a magnetic rack until the eluate is clear and colourless.
5m
Carefully remove and retain 35 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.

Note
Quantify 1 µL of the eluted sample using a Qubit fluorometer (Qubit DNA HS)


2m
Adapter ligation and clean-up
1h 8m
Thaw all reagents at Room temperature . Mix gently by pipetting, then briefly spin down. Place all reagents On ice .
In a 1.5 ml Eppendorf LoBind tube, mix in the following order:
ReagentVolume
Pooled barcoded sample30 µL
Native Adapter (NA)5 µL
NEBNext Quick Ligation Reaction Buffer (5X)10 µL
Quick T4 DNA Ligase5 µL
Total50 µL
Note
IMPORTANT
The Native Adapter (NA) used in this kit and protocol is not interchangeable with other sequencing adapters.
Do NOT vortex the Quick T4 DNA Ligase.

3m
Thoroughly mix the reaction by gently pipetting up and down, then briefly spin down.
1m
Incubate the reaction for 00:20:00 at Room temperature

20m
Resuspend the AMPure XP Beads (AXP) by vortexing.
1m
Add 20 µL of resuspended AMPure XP Beads (AXP) to the reaction and mix thoroughly by pipetting.

1m
Incubate on a Hula mixer for 00:10:00 at Room temperature

10m
Spin down the sample, then pellet it on the magnetic rack. Keep the tube on the magnet and carefully pipette off the supernatant.
5m
Wash the beads by adding 125 µL Short Fragment Buffer (SFB). Flick the tube to resuspend the beads, then briefly spin down. Return the tube to the magnetic rack and allow the beads to pellet. Carefully remove and discard the supernatant using a pipette.

Note
IMPORTANT:
Use Short Fragment Buffer (SFB) rather than 80% ethanol to wash the beads, as ethanol can be detrimental to the sequencing reaction.

5m
Repeat Step 133 for a total of two washes.
5m
Spin down the tube and place it back on the magnetic rack. Carefully pipette off any residual supernatant.
2m
Remove the tube from the magnetic rack and resuspend the pellet in 15 µL of Elution Buffer (EB).

2m
Spin down the tube and incubate for 00:10:00 at 37 °C . Every 00:02:00 , gently flick the sample for 00:00:10 to promote DNA elution.

10m
Pellet the beads on a magnet until the eluate is clear and colourless, for at least 00:01:00

1m
Carefully remove and retain 15 µL of the eluate containing the DNA library in a clean 1.5 mL Eppendorf DNA LoBind tube.
Note
Quantify 1 µL of the eluted sample using a Qubit fluorometer (Qubit DNA HS)
The prepared library is now ready for loading onto the flow cell. Store the library on ice until it is ready to be loaded.


2m
Priming and loading on the SpotON flow cell
27m 30s
In a 1.5 mL Eppendorf LoBind tube, mix in the following order:
ReagentVolume per flow cell
Flow cell flush (FCF)1170 μL
Bovine serum albumin (BSA) at 50 mg/mL5 μL
Flow cell tether (FCT)30 μL
Total1205 μL

Note
Mix by pipetting at room temperature

2m
Place the flow cell on the sequencing device and follow the manufacturer's instructions for setup and operation.

MinION Flow Cell

1m
Complete a flow cell check to assess the number of pores available before loading the library.
5m
Slide the flow cell priming port cover clockwise to open the priming port.
30s
After opening the priming port, check for a small air bubble under the cover. Drawback a small volume to remove any bubbles by following these sub-steps
Note
Visually check for a continuous buffer from the priming port across the sensor array.

30s
Set a P1000 pipette to 200µL
30s
Insert the tip into the priming port
30s
Turn the wheel until the dial shows 220-230 µL , to draw back 20-30 µL or until you can see a small volume of buffer entering the pipette tip.

Note
IMPORTANT
Take care when drawing back thebuffer from the flow cell. Do not remove more than 20-30 μl, and make sure that the array of pores is covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage pores.

30s
Load 800 µL of the priming mix into the flow cell via the priming port, avoiding introducing air bubbles. Wait for 00:05:00 . During this time, prepare the library for loading by following the steps below.
5m
Thoroughly mix the contents of the Library Beads (LIB) by pipetting.
1m
In a new 1.5 m Eppendorf DNA LoBind tube, prepare the library for loading as follows:
ReagentVolume per flow cell
Sequencing Buffer (SB)37.5 μL
Library Beads (LIB) mixed immediately before use25.5 μL
DNA library12 μL
Total75 μL

2m
Complete the flow cell priming:
30s
Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
30s
Load 200 µL of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding introducing air bubbles.
30s
Mix the prepared library gently by pipetting up and down just before loading.
30s
Add 75 µL of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

2m
Gently replace the SpotON sample port cover, ensuring the bung enters the SpotON port. Close the priming port. Place the light shield onto the flow cell. Close the device lid and set up a sequencing run. Start sequencing.
5m
Protocol references
ZymoBIOMICS DNA/RNA Miniprep Kit: Microbiome DNA and RNA from any sample. Catalog no. R2002
Pan-Prokaryote riboPOOL Kit Manual v1.1 (2019)
HighPrep RNA Elite Manual v1.01. Catalog No. RC-90050
Ligation Sequencing gDNA Native Barcoding V14 SQK-NBD114.24 (2022) ONT
Ligation Sequencing v14: Direct cDNA Sequencing DCS_9187_v114 (2023) ONT
Agencourt AMPure XP Information For Use Guide PN B37419AB (2016)
Acknowledgements
The research's funding comes from the Research Council of Norway as part of the DeepSeaQuence project (Project Number: 315427).