Jun 07, 2023

Nanopore amplicon sequencing with DIY adapter

  • 1National Chung Hsing University, Taichung;
  • 2Kaohsiung Medical University
  • Jho
Icon indicating open access to content
QR code linking to this content
Protocol CitationJie Hao Ou, Yin-Tse Huang 2023. Nanopore amplicon sequencing with DIY adapter. protocols.io https://dx.doi.org/10.17504/protocols.io.5jyl8jow9g2w/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 31, 2023
Last Modified: September 13, 2023
Protocol Integer ID: 79804
Keywords: diy adapter nanopore amplicon, nanopore amplicon, amplicon, diy adapter
Abstract
Nanopore amplicon sequencing with DIY adapter
Workflow


Preparation of amplicons
Use a primer with a HEAD to make amplicons, as in a regular procedure.
Enzymes with or without proofreading can be used, and purification is not necessary.
Use a barcoding index for the second PCR.
Note:
1. non-proofreading enzyme (Taq) must be used to add a A tail to the PCR product.
Purify the PCR product and adjust the final concentration of the purified DNA to ~50 ng/ul.
Pooling & 5' Phosphorylation

Mix the following materials in order:
(10 samples as an example)
AB
Sterile water7 ul
10X T4 Polynucleotide Kinase Reaction Buffer (with 1 mM ATP)2 ul
T4 Polynucleotide Kinase (10U/ul)1 ul
PCR product (x10 samples)1 ul x 10 samples = 10 ul
Note: Some manufacturers' buffers require additional ATP to be added to achieve a final reaction concentration of 0.1 mM.
Incubate at 37°C for 30 minutes.
30m
Heat inactivate by incubating at 65°C for 20 minutes
20m
Purify the DNA and adjust the final concentration to ~50 ng/ul.
Preparation of Adapter
1h 4m
Order the following two primers:
Adapter_top: TTTTTTTTCCTGTACTTCGTTCAGTTACGTATTGCT
Adapter_bottom: GCAATACGTAACTGAACGAAGTACAGG
Preferably, choose OPC or a higher level of purification method.
Dilute both primers to 100uM according to the manufacturer's instructions
(TE buffer is recommended)
1m
Mix both primers together in equal volumes.
(Now it is 50 uM)
1m
Incubate the mixture in a dry bath at 95°C for 2 minutes.


Ideally, Adapter_top and Adapter_bottom would aneal to form a sticky end of double strand DNA

2m
Allow the mixture to slowly cool to room temperature for one hour.
1h
Make 1:10 dilution (5 uM)
Store the mixture at 4°C or in a freezer for long-term storage.
When necessary, divide the mixture into smaller portions to avoid repeated thawing.
Attach adapter to PCR products.
1h
Mix the following materials in order:

AB
5' Phosphorylated PCR product (50ng/ul)10 ul
Sterile water7 ul
10X T4 DNA Ligase Buffer (with 1 mM ATP)2 ul
Adapter0.1 ul
T4 ligase1 ul (300U or 2.5U in Weiss Unit)
Note: Some manufacturers' buffers require additional ATP to be added to achieve a final reaction concentration of 0.1 mM.

Incubate at 16-20 °C for at least 01:00:00

1h
Purify the DNA and adjust the final concentration to ~50 ng/ul.