Sep 06, 2022

Nano-CUT&Tag for multimodal profiling of the chromatin V.2

Nano-CUT&Tag for multimodal profiling of the chromatin
  • 1Karolinska Institute Stockholm
Icon indicating open access to content
QR code linking to this content
Protocol CitationMarek Bartosovic, Goncalo Castelo-Branco 2022. Nano-CUT&Tag for multimodal profiling of the chromatin. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv59o8dg1b/v2Version created by Marek Bartosovic
Manuscript citation:
Bartosovic, M., Castelo-Branco, G. Multimodal chromatin profiling using nanobody-based single-cell CUT&Tag.Nat Biotechnol(2022). https://doi.org/10.1038/s41587-022-01535-4
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 05, 2022
Last Modified: September 06, 2022
Protocol Integer ID: 69579
Keywords: CUT&Tag, Histone modifications, single-cell, nanobody, Tn5, chromatin nano, novel tn5 fusion protein, several histone modification, open chromatin at the same time, open chromatin, histone modification, 10x genomics platform, novel tagmentation protocol, multimodal profiling, nano
Disclaimer
This protocol includes portions that are excerpted from works © 2018-2022 10x Genomics, Inc. (10x Genomics) and reproduced here with permission. All other rights reserved. The use of 10x Genomics products in practicing the methods set forth herein has not been validated by 10x Genomics, and such non-validated use is not covered by 10x Genomics’ standard warranty, and 10X GENOMICS HEREBY DISCLAIMS ANY AND ALL WARRANTIES FOR SUCH USE. Nothing in this document should be construed as altering, waiving or amending in any manner 10x Genomics’ terms and conditions of sale or use for its products and software, including without limitation such terms and conditions relating to certain use restrictions, limited license, warranty and limitation of liability, and nothing in this document shall be deemed to be Documentation, as that term is set forth in such terms and conditions of sale. Nothing in this document shall be construed as any representation by 10x Genomics that it currently or will at any time in the future offer or in any way support any application set forth herein.

Abstract
Nano-CUT&Tag is a multimodal technology to profile several histone modifications at the same with single-cell resolution. Nano-CUT&Tag implements a novel Tn5 fusion proteins to anti-mouse and anti-rabbit secondary nanobodies. Optionally, ATAC-seq can be performed prior on the same sample to profile open chromatin at the same time. Novel tagmentation protocol, which involves two-step tagmentation by MeA and MeB oligonucleotides yields increased number of fragments per cell comparing to previous single-cell CUT&Tag protocols on 10x Genomics platform.

Figure 1. Comparison of scCUT&Tag and nano-CT tagmentation protocol
Figure 2. Depiction of the new tagmentation strategy of nano-CT. First nuclei are tagmented by nano-Tn5 loaded with MeA oligonucleotides. After single-cell barcoding and DNA recovery/purification, it is tagmented randomly with standard Tn5 loaded with MeB oligonucleotides.




Figure 3. Number of fragments per cell in nano-CT comparing to single-cell CUT&Tag

Figure 4. Multimodal UMAP projection of 3 epigenetic modalities measured in the mouse brain




Guidelines
This protocol involves large number of centrifugation steps, and it is critical to prevent nuclei loss and/or clumping. Therefore, always use swinging bucket rotor centrifuge for all centrifugation steps, include 2% BSA in all buffers which come in contact with nuclei and carefully aspirate the supernatant. It is better to leave cca 5-10 ul of supernatant in the tube rather than lose the nuclei.

Clumping of nuclei can be a problematic, but generally, having cleaner nuclei helps to prevent clumping. Removing of debris from your sample is highly recommended. For mouse brain Debris Removal Solution has proven to be effective in removing excess debris (Miltenyi, 130-109-398).

Some steps in this protocol involve usage of in-house produced Tn5/nano-Tn5. Individual tagmentation steps should be optimised according to specific batch of the proteins.

The two-step tagmentation protocol can also be performed with pA-Tn5 protein. Load pA-Tn5 only with MeA/Me-Rev oligos and follow the protocol as described here. pA-Tn5 profiling should be compatible with ATAC-seq in the same sample, but this was not tested.
Materials


Preparation of buffers:




oligonucleotide sequences:

Tn5_MeA_P5_noBCD.
5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdA.
5'-TCGTCGGCAGCGTCT TATAGCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdB
5'-TCGTCGGCAGCGTCT ATAGAGGC GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdC
5'-TCGTCGGCAGCGTCT CCTATCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5ME-B:
5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′

Tn5MErev.
5'-[phos]CTGTCTCTTATACACATCT-3'

Additional barcodes can be selected based on:

Amini, S., Pushkarev, D., Christiansen, L. et al. Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing. Nat Genet 46, 1343–1349 (2014). https://doi-org.proxy.kib.ki.se/10.1038/ng.3119

Download 41588_2014_BFng3119_MOESM2_ESM.xlsx41588_2014_BFng3119_MOESM2_ESM.xlsx


Material:

Tn5 loading:
250mM Hepes pH 7.2, homemade or commercial alternative
Glycerol (ThermoFischer 327255000)
5M NaCl (Invitrogen, AM9759)
0.5M EDTA (Invitrogen, AM9260G)
1M DTT (ThermoFisher, P2325)
10% Triton-X (ThermoFisher, 85111)
anti-rabbit-Tn5 (nano-Tn5, Addgene #183637) in house purified, no commercial option to date
anti-mouse-Tn5 (nano-Tn5, Addgene #183638) in house purified, no commercial option to date
unloaded Tn5 enzyme- in house purified (There are several commercial options available for example from lucigen or diagenode)

ATAC-seq

1x PBS
10% Tween-20 (Bio-Rad, 1706531)
5% Digitonin in DMSO (EMD Milipore, 300410)
Tn5 transposase protein (for ATAC-seq)
Nuclease free water (ThermoFisher, 10977015)
0.5M EDTA (Invitrogen, AM9260G)
1M Tris pH7.5
5M NaCl (Invitrogen, AM9759)
1M MgCl2 (Invitrogen, AM9530G)
10%NP-40 (Thermo, 85124)
Dimethylformamide (Sigma, 227056)

nano-CUT&Tag

5% Digitonin in DMSO (EMD Milipore, 300410)
BSA (Sigma, A9418)
1M Hepes pH7,5 (Alfa Aesar, J60712)
5M NaCl (Invitrogen, AM9759)
Spermidine (ThermoFisher, A19096.06)
Complete EDTA-free protease inhibitors (Roche, 11873580001)
0.5M EDTA (Invitrogen, AM9260G)
10%NP-40 (Thermo, 85124)
1M MgCl2 (Invitrogen, AM9530G)
Counting chambers (VWR, 630-1893)
Chromium Next GEM Chip H Single Cell Kit
Chromium Next GEM Single Cell ATAC Library & Gel Bead Kit v1.1
Single Index Kit N Set A
1M Tris pH7.5
Dimethylformamide (Sigma, 227056)
Zymo DNA Clean and concentator-5 kit
SPRI beads (Beckman Coulter, B23318)
Ethanol, Pure (200 Proof, anhydrous, Milipore Sigma, E7023)
10% Tween-20 (Bio-Rad, 1706531)
Qiagen Buffer EB (Qiagen, 19086)
Bioanalyser or Tapestation with appropriate kits

Swinging bucket rotor centrifuge
Appropriate adaptors for 0.5 ml tubes

Custom sequencing primers:
>Custom_primer_R1
GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
>Custom_primer_I2
CTGTCTCTTATACACATCTGCCGTCCTCGATCGC Validated primary antibodies in nano-CT

rabbit:
H3K27ac (Abcam, Ab177178)

mouse:
H3K27me3 (Abcam, Ab6002)


Validated primary antibodies for scCUT&Tag
H3K27ac (Abcam, Ab177178) H3K4me3 (Diagenode, C15410030)
H3K27me3 (Cell Signalling, 9733T)
H3K36me3 (Abcam, Ab9050)




Safety warnings
Digitonin is toxic and care should be taken especially when weighing out the powder. Use full PPE including a mask, lab coat and gloves while handling any amount of digitonin.
Before start
Before starting, make yourself familiar with the 10x genomics Chromium Single Cell ATAC Reagent Kits User Guide (v1.1 Chemistry).

Follow all the best practices and tips given in the 10x genomics Chromium Single Cell ATAC Reagent Kits User Guide.

This protocol is compatible with Chromium Next GEM Single Cell ATAC Library & Gel Bead Kit v1.1 has not been tested with Chromium Next GEM Single Cell ATAC Kit v2.

Download CG000209_Chromium_NextGEM_SingleCell_ATAC_ReagentKits_v1.1_UserGuide_RevF.pdfCG000209_Chromium_NextGEM_SingleCell_ATAC_ReagentKits_v1.1_UserGuide_RevF.pdf

Tn5 loading
2h 45m
Annealing adaptor sequences:

Tn5_MeA_P5_noBCD.
5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdA.
5'-TCGTCGGCAGCGTCTCCACGC TATAGCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdB
5'-TCGTCGGCAGCGTCTCCACGC ATAGAGGC GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5_MeA_P5_bcdC
5'-TCGTCGGCAGCGTCTCCACGC CCTATCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

Tn5ME-B:
5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′

Tn5MErev.
5'-[phos]CTGTCTCTTATACACATCT-3'




Note
Warning: There are wrong oligonucleotide sequences stated in the version 1 of this protocol, which are inconsistent with the biorXiv preprint. These sequences are corrected in this version of the protocol.

Tn5_MeA_P5_bcdA.
5'-TCGTCGGCAGCGTCT TATAGCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
Tn5_MeA_P5_bcdB
5'-TCGTCGGCAGCGTCT ATAGAGGC GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
Tn5_MeA_P5_bcdC
5'-TCGTCGGCAGCGTCT CCTATCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG

was changed to:

Tn5_MeA_P5_bcdA.
5'-TCGTCGGCAGCGTCTCCACGC TATAGCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
Tn5_MeA_P5_bcdB
5'-TCGTCGGCAGCGTCTCCACGC ATAGAGGC GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
Tn5_MeA_P5_bcdC
5'-TCGTCGGCAGCGTCTCCACGC CCTATCCT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG


Note
Nano-CUT&Tag can be performed in its barcoded (multimodal) and unbarcoded version (single histone modality)

Note
Optionally, extra nucleotides can be included to prevent low complexity in sequencing of adaptor part of the library, if using sequencing platform sensitive to low complexity regions.

Equimolar ratio of the 4 following oligonucleotides shoul then be used.

For example for barcode A:

>Tn5_P5_MeA_BcdA_0N TCGTCGGCAGCGTCTCCACGCTATAGCCTGCGATCGAGGACGGCAGATGTGTATAAGAGACAG
>Tn5_P5_MeA_BcdA_1N TCGTCGGCAGCGTCTCCACGCTATAGCCTNGCGATCGAGGACGGCAGATGTGTATAAGAGACAG
>Tn5_P5_MeA_BcdA_2N TCGTCGGCAGCGTCTCCACGCTATAGCCTNNGCGATCGAGGACGGCAGATGTGTATAAGAGACAG
>Tn5_P5_MeA_BcdA_3N TCGTCGGCAGCGTCTCCACGCTATAGCCTNNNGCGATCGAGGACGGCAGATGTGTATAAGAGACAG

This should not be necessary for NovaSeq and HiSeq platforms, but sequence on your own risk.



Resuspend the oligonucleotides (Tn5ME-A, Tn5ME-B, Tn5MErev) in water to a final concentration of 100µM each.
10m
Mix equimolar amounts of Tn5MErev/Tn5ME-A and Tn5MErev/Tn5ME-B in separate 200 µl PCR tubes.

e.g:

tube1: 10 µL Tn5ME-A + 10 µL Tn5MErev
tube2: 10 µL Tn5ME-B + 10 µL Tn5MErev

5m
Denature in the thermocycler for 00:05:00 at 95 °C , and cool down slowly on the thermocycler by ramping down to 20 °C by 0.1 °C per second

Pause point: Store the annealed oligos at -20 °C

1h
Mix annealing mix.

The final Tn5 concentration is 2 micromolar (µM) of Tn5 dimer

Use unique barcodes for specific nano-Tn5 or WT-Tn5.

Mouse Nano-Tn5 (MeA/P5 loaded):

4 µL Annealed, barcoded MeA/Me-Rev oligos 50 micromolar (µM) (e.g. barcode A, Me-A/Me-Rev)
21 µL Glycerol
3 µL Nano-Tn5 (mouse, 5mg/ml, MW = 73941 g/mol; 67.6 micromolar (µM) )
22 µL 2x Tn5 loading buffer


Rabbit Nano-Tn5 (MeA/P5 loaded):
4 µL Annealed, barcoded MeA/Me-Rev oligos 50 micromolar (µM) (e.g. barcode B, Me-A/Me-Rev)
21 µL Glycerol
2.2 µL Nano-Tn5 (rabbit, 6.8mg/ml, MW = 73013 g/mol 93.1 micromolar (µM) )
22.8 µL 2x 2x Tn5 loading buffer


WT Tn5-MeA with barcode (for ATAC-seq)

4 µL Annealed, barcoded MeA/Me-Rev oligos 50 micromolar (µM) (e.g. barcode C, Me-A/Me-Rev)
21 µL Glycerol
3.1 µL Tn5 (3.5 mg/ml, MW = 53300 g/mol 65.7 micromolar (µM) )
21.9 µL 2x 2x Tn5 loading buffer


WT Tn5-MeB unbarcoded (for 2nd tagmentation)

4 µL Annealed MeB/Me-Rev oligos 50 micromolar (µM) (un-barcoded, Me-B/Me-Rev)
21 µL Glycerol
3.1 µL Tn5 (3.5 mg/ml, MW = 53300 g/mol 65.7 micromolar (µM) )
21.9 µL 2x Tn5 loading buffer



Note
Adjust the volumes for specific nano-Tn5 protein batch for final 2 micromolar (µM) nano-Tn5 dimer.

The volume of nano-Tn5 and 2x Tn5 loading buffer should add up to 25 µL and volume of oligos and glycerol also adds up to 25 µL .

Optionally scale up or down the reactions as necessary.




2x Dialysis buffer
100 mM HEPES-KOH pH7.2, 200 mM NaCl, 0.2 mM EDTA, 0.2% Triton-X, 20% Glycerol, Store at 4 °C ;
Add DTT fresh to the 2x dialysis buffer just before loading (2mM final). Keep 200 mM DTT stock at -20 °C

For details on buffer preparation see Materials section
30m
Incubate for 01:00:00 at Room temperature

1h
Store the loaded nano-Tn5 at -20 °C

ATAC-seq (optional)
1h 30m
Dissociate tissues/cells of interest by desired method and obtain single-cell suspension. Wash the cells once with 1x PBS


Note
ATAC-seq protocol is based on the Omni-ATAC protocol (Corces et al., 2017).


10m
Centrifuge the cells for 00:10:00 at 300x g at 4 °C . Discard the supernatant.

15m
Add 200 µL of ATAC lysis buffer (for 200,000 cells, see materials section for buffer recipe). Pipette up and down gently 3x and incubate on ice for 00:03:00


Note
Scale the volume of lysis buffer down for lower cell input (e.g. 50ul for 50,000 cells)

5m
Add 1 mL of ATAC wash buffer and gently invert the tube 3x.

Centrifuge at 500x g for 00:10:00 . Discard the supernatant.

10m
Prepare transposition mix:


100 µL 2X TD Buffer (see materials section) 66 µL 1X PBS 2 µL 10% Tween-20 (final 0.1% v/v) 2 µL 1% Digitonin (final 0.01% v/v) 10 µL Tn5 Transposase (loaded with uniquely barcoded oligonucleotides-MeA only) 20 µL nuclease-free H2O
10m
Resuspend the nuclei in 200 µL of transposition mix (for 200,000 cells).

Note
Scale the volume of transposition mix down for lower cell input (e.g. 50ul for 50,000 cells)





5m
Incubate for 00:30:00 at 37 °C in thermomixer at 1000 rpm.

30m
Stop the tagmentation by adding 10 µL of 500 mM EDTA. Mix by pipetting up and down 3x.

Centrifuge for 00:10:00 at 500x g

10m
Remove the supernatant. Resuspend in 200 µL of CUT&Tag Antibody buffer.

Centrifuge for 00:03:00 at 600x g. Remove the supernatant.

Proceed to CUT&Tag Antibody binding (Step 23).

3m
CUT&Tag Nuclei isolation (nano-CUT&Tag without ATAC)
15m
Dissociate tissues/cells of interest by desired method and extract nuclei by incubation for 00:03:00 in 200 µL of Antibody buffer on ice.


Note
Amount of input material can range from 25,000 - 200,000, depending on tissue or cell type and whether ATAC-seq is performed together with nano-CUT&Tag

Note
If ATAC-seq is desired, good starting point is 200,000 cells.

In case ATAC-seq is not done, good starting point is 100,000 cells.

5m
Centrifuge the nuclei for 00:03:00 at 600x g.

5m
Remove the supernatant.
Note
To prevent loss of nuclei, all centrifugations and incubations should be done in 0.5 ml micro-tubes. This makes it possible to see the nuclei better even for low input samples (e.g. 50,000 cells).

All centrifugation steps should be performed in swinging bucket rotor centrifuge with the appropriate adaptors.

When removing supernatant, it is ok to leave ~10ul of the supernatant in the tube, to prevent loss of nuclei.



Swinging bucket rotor centrifuge
Adaptor for 1.5 ml tubes
Adaptor for 0.5 ml tubes

Antibody binding
Prepare antibody mix

Starting concentrations (can be further optimised, depending on the antibody)


1:100 primary antibody
1:100 nano-Tn5

Final volume 100ul per sample.
Resuspend the nuclei pelet in the prepared antibody mix (1:100 primary antibody, 1:100 nano-Tn5) by pipetting up and down 5x.
Incubate Overnight on with rotation on a horizontal roller at 4 °C
Roller for overnight incubation

Note
Make sure the liquid does not reach the cap of the tube during the incubation, as nuclei can get stuck in the cap.

Washing and Tagmentation
1h 34m
The next day, centrifuge for 00:03:00 at 600xg.

10m
Remove the supernatant and resuspend in 200 ul of Dig-300 wash buffer.


Note
Eject the buffer, with medium speed, so the pellet is dispersed, but do not pipette-mix (unless necessary, this might lead to loss of nuclei) or do not create excessive bubbles.

10m
Repeat the steps 27-28 for total of 2 washes.
Resuspend the nuclei pellet in 200 ul of Tagmentation buffer. Pipette mix 5x to resuspend the pellet.
5m
Incubate for 01:00:00 at 37 °C


Note
Pipette mix the nuclei ~30 minutes into the incubation to prevent sedimentation.

If there is no suitable adapter for 0.5 ml tubes in the thermomixer, use 1.5ml eppendorf tubes with ~800ul of water as adapters or use water bath.

1h
During the incubation prepare tagmentation STOP buffer.

Prepare 2x diluted nuclei buffer (DNB) from 20x nuclei buffer (10x scATAC-seq, PN: 2000207). Store the aliquots of 2x DNB at -20 °C

Stop buffer:

100 µL 2x Diluted Nuclei buffer
20 µL 20% BSA
70 µL water
10 µL 500 mM EDTA).


1x DNB + BSA buffer:

500 µL 2x Diluted Nuclei buffer (10x scATAC-seq kit, dilute down from 20x (PN: 2000207))
100 µL 20% BSA
400 µL water


Stop the tagmentation by removing from 37 thermoblock and adding 200 µL of STOP buffer. Mix well by pipetting up and down 3x.

Centrifuge for 00:03:00 at 300x g. Remove supernatant

3m
Resuspend the nuclei in 200 µL of 1x DNB+BSA buffer.

Centrifuge for 00:03:00 at 300x g. Remove supernatant

3m
Resuspend the nuclei in 200 µL of 1x DNB+BSA buffer.

Centrifuge for 00:03:00 at 300x g.

3m
Remove the most of the supernatant, leave the nuclei in cca 10 µL of remaining 1xDNB+BSA buffer.

Add 10 µL of 1xDNB+BSA buffer, for final 20 ul of nuclei suspension. Measure the exact volume using P20 pipette.

Nuclei counting )
45m
Count the concentration of nuclei. Use 2 µL of nuclei suspension and mix with 8 µL of trypan blue. For counting use manual counting chambers (VWR, 630-1893). Do the counting in two replicates for more accuracy.



30m
To aim for cca 5,000 recovered nuclei, load cca 16,000 nuclei or determine ratio of loaded/recovered nuclei empirically.


Note
In our experience, the recovery of nuclei after 10x barcoding is lower, comparing to loading recommendations from 10x genomics for scATAC-seq.

The ratio of loaded/recovered nuclei can vary based on specific biological sample and nuclei preparation.

Chromium Next GEM barcoding
1h 40m

Note
The next part of the protocol follows closely the Chromium Next GEM Single Cell ATAC Reagent Kits v1.1 Steps 2.0-2.5

Note
Make yourself familiar with the 10x Genomics scATAC-seq kit manual before proceeding.
Download CG000209_Chromium_NextGEM_SingleCell_ATAC_ReagentKits_v1.1_UserGuide_RevF.pdfCG000209_Chromium_NextGEM_SingleCell_ATAC_ReagentKits_v1.1_UserGuide_RevF.pdf

Mix the GEM generation and barcoding mix. Use the desired volume of nuclei and fill up to 15 µL with 1x DNB+BSA buffer.


Prepare nuclei mix and keep it on ice:


7 µL ATAC buffer B
X µL Nuclei (Use =< 8ul of nuclei)
up to 15 µL 1x DNB+BSA buffer

keep on ice
15m
Prepare barcoding mix and :

56.5 µL Barcoding reagent B
1.5 µL Reducing agent B
2 µL Barcoding enzyme

keep it on ice
Assemble the Chromium Next GEM Chip H according to the manufacturer's instructions.






5m
Load the Chromium Next GEM Chip H according to the manufacturer's instructions. Run the droplet generation.




45m
Recover droplets from the Next GEM Chip H according to the manufacturer's instructions.



5m
Incubate in PCR cycler according to the manufacturer's instructions.

The linear amplification (LA) and single-cell barcoding occurs at this step.

Barcoding and linear amplification temperature program.

30m
Post-GEM incubation cleanup
1h
Perform post-GEM incubation cleanup according to manufacturer's instructions - Steps 3.1-3.2








45m
Use 2ul of the purified DNA to measure the concentration (optional) using Qubit high sensitivity dsDNA kit.

Note
We recommend measuring the DNA concentration at this stage, during optimisations experiments. The library is linearly amplified at this stage, so minor loss of sample is acceptable.

Optimal ratio of LA barcoding product and MeB Tn5 is critical to achieve maximum complexity of the library.

The DNA:Tn5 ratio can be optimised also in bulk experiments. Briefly:

1. perform this protocol until step 33.
2. Resuspend the nuclei in 100ul of Dig-300 buffer. A
3. Add 500ul of Zymo DNA clean and concentrator-5 binding buffer to the nuclei
4. Purify the gDNA using the zymo DNA clean and concentrator-5 kit
5. Elute DNA in 25 ul of elution buffer.
6. Use ~5ul of eluted DNA for linear amplification reaction (5ul DNA, 2ul 10x_LA primer_noBCD, 25ul 2x NEBnext mastermix, 18 ul water)
7. Run the program from 10x sATAC protocol - Step 2.5 GEM incubation (1. 72C 5min, 2. 98C 30s, 3. 98C 10s, 4. 59C 30s, 5. 72C 1min, 6. GOTO 3, 11x, 7. 15C hold infinite. )
8. Purify the product using 1.2x SPRI beads. Elute in 25 ul of EB buffer.
9. Measure concentration of DNA.
10. Mix 10ng of DNA with varying amounts of MeB-Tn5 (0.05ul-2ul) in 1x TD buffer final
11. incubate for 30 minutes at 37C
12. Purify using Zymo DNA clean and concentrator-5 kit. use 1:5 ratio of binding buffer to the sample. Elute the DNA in 25 ul
13. Use 10 ul of the eluted DNA for PCR (10 ul eluted DNA, 2ul PCR_FW primer 2ul Rev primer, 11ul water, 25ul 2x NEBnext MM).
14. Run PCR program as in step 53 PCR library amplification (1. 72C 5min, 2. 98C 45s, 3. 98C 20s, 4. 67C 30s, 5. 72C 20s, 6. GOTO 3, 7x, 7. 72C 1min, 8. 4C hold infinite. )
15. Run Bioanalyser/Tapestation to identify the optimal Tn5-MeB ratio to DNA

>10x_LA_primer_noBCD
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC
>PCR_FW_primer
AATGATACGGCGACCACCGAGA,
>PCR_Rev_primer
CAAGCAGAAGACGGCATACGAGAT [8-bp sample index] GTCTCGTGGGCTCGG

Note
Optimal ratio of our home-made WT Tn5 is 0.7ul of MeB-Tn5 to 10ng of barcoded LA product. This ratio should be determined specifically for each batch of Tn5.

Typical yield of multimodal nanoCT barcoded LA product is ~5-10 ng in our hands.

Good starting point for optimisation of MeB Tn5 amount is 0.5 µL for our Tn5

Commercial Tn5 enzymes (e.g. EZ-Tn5) can be more active than a typical homemade Tn5 and therefore might require higher dilution.


15m
MeB tagmentation and library preparation
1h 45m
Mix MeB tagmentation reaction:

38-40 µL Barcoded LA product (from previous step, typically 5-10 ng)
50 µL 2x TD buffer
0.5 µL MeB-loaded Tn5 (starting point, should be adjusted for specific batch of Tn5 and yield of DNA)
up to 100 µL Water

Incubate in PCR cycler 00:30:00 at 37 °C -> 4 °C hold
Heated lid at 50 °C

45m
Purify the DNA using Zymo DNA Clean and concentrator-5 kit according to manufacturer's instructions.

Transfer the sample into 1.5 ml eppendorf tube.
Add 500 µL of zymo binding buffer to your sample.
Wash 2x with 200 µL of zymo wash buffer.
Perform one more dry spin 1min at max speed to remove residual liquid.

Elute the DNA in 40 µL of DNA elution buffer (Zymo kit) . Incubate 2minutes on column, then centrifuge.

Download _D4003T_D4003_D4004_D4013_D4014_DNA_Clean_Concentrator_-5_ver_1_2_1_LKN-SW__1.pdf_D4003T_D4003_D4004_D4013_D4014_DNA_Clean_Concentrator_-5_ver_1_2_1_LKN-SW__1.pdf



15m
Run PCR library amplification:



40 µL Purified DNA from previous step (sample)
7.5 µL SI-PCR primer B (10x ATAC-seq kit; PN: 2000128)
2.5 µL Individual Single Index N Set A primer (product code: 1000212)
50 µL AMP mix (10x ATAC-seq kit; PN: 2000047/ 2000103)

Incubate in PCR cycler with the following program:

Lid temperature 105 °C , volume 100 µL .

1. 72 °C 5min
2. 98 °C 45sec
3. 98 °C 20sec |
4. 67 °C 30sec | Repeat 13x
5. 72 °C 20sec |
6. 72 °C 1min
7. 4 °C hold

Note
Typically we use 13 PCR cycles for library amplification, which is agood starting point, but the number of cycles should be adjusted according to typical yield for a specific combination of antibodies and input material.

We typically aim for 10nM library in the range of 300-700bp




Purify the final library using according to Step 4.2 in Chromium Next GEM Single Cell ATAC Reagent Kits v1.1.


Sequencing preparation
Sequence on Illumina NovaSeq v1.5 platform with read setup : 36-8-48-36 (R1-I1-I2-R2) using custom sequencing primers:

Custom_primer_R1: GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
Custom_primer_I2: CTGTCTCTTATACACATCTGCCGTCCTCGATCGC


R2 & I1 standard
Library structure:

P5 side:



P7 side:



We typically aim for ~25,000 read pairs per cell, meaning 125,000,000 reads for 5000 cells (~one 10x lane).
Desired outcome
Typical bioanalyzer trace of a successful experiment shows good and even distribution of fragment sizes and is not overtagmented or undertagmented. Both over- and under- tagmenation will lead to reduced complexity of the library.

Bioanalyzer trace showing a successful multimodal nano-CUT&Tag library. Majority of fragments are
between 300-1000 bp


Bioanalyzer trace of under-tagmented nano-CUT&Tag library - increase the amount of Tn5-MeB in library prep




Bioanalyzer trace of over-tagmented nano-CUT&Tag library - decrease the amount of Tn5-MeB in library prep