Jun 27, 2024

Mutant generation in Streptococcus mitis strain B6

  • 1Nationwide Children's Hospital
Icon indicating open access to content
QR code linking to this content
Protocol CitationSamantha King 2024. Mutant generation in Streptococcus mitis strain B6. protocols.io https://dx.doi.org/10.17504/protocols.io.261ge5ezyg47/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 26, 2024
Last Modified: June 27, 2024
Protocol  Integer ID: 102478
Keywords: Transformation, mutagenesis, Streptococcus mitis B6, mutant generation in streptococcus, insertion deletion mutants in streptococcus, mitis strain b6 this protocol, mitis strain b6, insertion deletion mutant, streptococcus, mutant generation
Funders Acknowledgements:
American Heart Association
Grant ID: 19TPA34760750
Abstract
This protocol is the methodology that we have successfully employed to generate and confirm insertion deletion mutants in Streptococcus mitis strain B6. Attached to the protocol is a file that includes primers for the MonX mutation
Materials
Table 1: Primers Used in This Study
ABCD
Target Name Sequence 5’ to 3’ Location (accession no.)
Spec S1 CGATTTTCGTTCGTGAATAC 5418–5399 (KM009065)
S2 TATGCAAGGGTTTATTGTTTTC 4265–4286 (KM009065)
pJet P1 CGACTCACTATAGGGAGAGCGGC 310-332 (EF694056.1)
P2 AAGAACATCGATTTTCCATGGCAG 405-428 (EF694056.1)
Safety warnings
Appropriate biosafety procedures need to be followed
Streptococcus mitis B6 mutagenesis protocol
Creation of a plasmid construct
The regions upstream and downstream of the region to be deleted were amplified using primers 1 and 2, and 3 and 4, respectively. These primers were designed to contain appropriate overhangs to allow In-fusion with pJET 1.2/blunt and the antibiotic resistance cassette.  
The spectinomycin resistance cassette (aad9) was amplified using primers S1 and S2
PCR products were then purified with a Qiagen PCR Purification Kit
The three fragments for each mutant construct were cloned into pJET 1.2/Blunt (Thermo Fisher Scientific) using In-Fusion Snap Assembly (Takara) and transformed into Escherichia coli stellar competent cells.
Transformants were selected on LB agar plates supplemented with ampicillin (100 µg/ml) and incubated at 37oC overnight
The resulting colonies were confirmed as ampicillin resistant by streaking on a new LB agar plate supplemented with ampicillin (100 µg/ml).
Transformants were screened by colony PCR using pJET 1.2/blunt Fwd and Rev primers.
For transformants giving an appropriate PCR product, a 5 mL LB culture supplemented with ampicillin (100 µg/ml) was grown overnight at 37 °C with shaking at 200 rpm.
The plasmid was then purified using Qiagen Miniprep Kit and confirmed by sequencing
Transformation of S. mitis B6
Strains were growth at 37°C in C+Y pH8 [1] – starting at a low inoculum i.e. from a plate or diluting from a culture 1:100 (starting optical density at 600nm [OD600] = 0.03 to 0.05).
When the culture was close to OD600 =0.1, 950 μl of C+Y pH 8.0 medium was added to a 1.5 ml tube with 10 μl of 100 mM CaCl2, 2 μl of competence stimulating peptide (CSP) (EMRKPDGALFNLFRRR - 1 mg/ml), and 150 ng of DNA. A no DNA control tube is included to account for potential contamination.  These tubes were prewarmed in a waterbath to 37°C.
When the culture reached an OD600 of 0.10 to 0.12, 50 μl of culture was added to the prewarmed tubes.
Tubes were incubated in a waterbath at 37 °C for 2 hr.
Reactions were pelleted by centrifugation and resuspended in approximately 100 µl of media. This was plated on selective Tryptic Soy Agar (TSA) plates spread with 5000 U catalase (Worthington Biochemical Corporation).
Plates were incubated at 37oC in 5% CO2 overnight and then patched onto selective plates.
Confirmation of putative transformants
Putative transformants were grown in tryptic soy broth and DNA prepared as previously described [2].
The mutations were confirmed by PCR and sequencing (using primers S1 and S2) or genome sequencing.
Protocol references
1.         LACKS S, HOTCHKISS RD. A study of the genetic material determining an enzyme in Pneumococcus. Biochim Biophys Acta. 1960;39:508-18. doi: 10.1016/0006-3002(60)90205-5. PubMed PMID: 14413322.
2.         Gaytán MO, Singh AK, Woodiga SA, Patel SA, An SS, Vera-Ponce de León A, et al. A novel sialic acid-binding adhesin present in multiple species contributes to the pathogenesis of Infective endocarditis. PLoS Pathog. 2021;17(1):e1009222. Epub 20210119. doi: 10.1371/journal.ppat.1009222. PubMed PMID: 33465168; PubMed Central PMCID: PMCPMC7846122.