Sep 30, 2025
Multiplexed RT-qPCR to screen for SARS-COV-2 B.1.1.7, B.1.351, and P.1 variants of concern
- Chantal Vogels1,
- Joseph Fauver1,
- Nathan Grubaugh1
- 1Department of Epidemiology of Microbial Diseases, Yale School of Public Health
Protocol Citation: Chantal Vogels, Joseph Fauver, Nathan Grubaugh 2025. Multiplexed RT-qPCR to screen for SARS-COV-2 B.1.1.7, B.1.351, and P.1 variants of concern. protocols.io https://dx.doi.org/10.17504/protocols.io.14egnreyql5d/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 29, 2025
Last Modified: September 30, 2025
Protocol Integer ID: 228475
Keywords: qpcr assay, targeted molecular surveillance method, urgent need for targeted molecular surveillance method, testing virus, pcr test, variant surveillance, applied biosystems taqpath, spike gene target failure, other sar, sufficient virus rna, emergence of sar, gene target failure, multiplexed assay, qpcr, pcr, cdc n1 primer, virus, gene target, sequencing confirmation, sar
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
With the emergence of SARS-CoV-2 variants that may increase transmissibility and/or cause escape from immune responses, there is an urgent need for targeted molecular surveillance methods. While sequencing is the gold standard, it cannot always be immediately scaled or implemented in some settings to detect variants when their frequencies are low. The Applied Biosystems TaqPath COVID-19 assay (ThermoFisher), a PCR test, was discovered to have a distinct signature (spike gene target failure, [SGTF]) when testing viruses containing the Δ69/70 HV deletion, like the B.1.1.7 variant first detected in the UK. However, a sample with a SGTF is not definitive for B.1.1.7, and cannot detect other variants of concern that lack the Δ69/70 HV deletion, such as B.1.351 detected in South Africa and P.1 recently detected in Brazil. We developed a multiplexed RT-qPCR assay that can detect all three variants by targeting the Δ3675-3677 SGF deletion in the ORF1a gene, which has not yet been widely detected in other SARS-CoV-2 lineages. Furthermore, by also targeting the Δ69/70 HV deletion in the spike gene, our assay can differentiate B.1.1.7 from B.1.351 and P.1. Finally, we include the CDC N1 primer and probe set in our multiplexed assay as a control to ensure that target failures are likely due to the presence of the ORF1a and/or spike deletions and that there is sufficient virus RNA for sequencing confirmation. Our multiplexed RT-qPCR assay can be rapidly scaled to support SARS-CoV-2 variant surveillance.
Guidelines
Disclaimer and intended use: This multiplexed protocol is still under development and is for research purposes only. It should not be used for clinical diagnosis. The intention of this assay is to screen for the probable presence of the B.1.1.7, B.1.351, and P.1 variants. Variant detection should be confirmed by sequencing.
Version 1: Draft protocol with primer-probe sets targeting the SARS-CoV-2 nucleocapsid (N1), spike 69-70 deletion, and human RNase P control.
Version 2: Updated protocol with primer-probe sets targeting the SARS-CoV-2 nucleocapsid (N1), spike 69-70 deletion, and ORF1a 3675-3677 deletion to differentiate between potential B.1.1.7, B.1.351, and P.1 variants of concern.
Version 3: Updated protocol with reduced N1 concentrations and clarifications on the used channels and conditions under which threshold were determined in the results interpretation section.
Materials
> MM; Luna Universal Probe One-Step Reaction Mix, 2X
> RT; Luna WarmStart® RT Enzyme Mix (20X)
> Nuclease-free water
> CDC_N1; Forward Primer (100 µM), Reverse primer (100 µM), probe (100 µM)
> Yale_69/70del; Forward Primer (100 µM), Reverse primer (100 µM), probe (100 µM)
> Yale_ORF1a-del; Forward Primer (100 µM), Reverse primer (100 µM), probe (100 µM)
| A | B | C | D | E | |
| Set name | Nt positions | TM | Primer/probe | Sequence | |
| CDC_N1 | 28,287 | 53.6 | Fwd primer | GACCCCAAAATCAGCGAAAT | |
| 28,335 | 57.7 | Rev primer | TCTGGTTACTGCCAGTTGAATCTG | ||
| 28,309 | 63.3 | Probe | FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 | ||
| Yale_69/70del | 21,710-21,733 | 59.3 | Fwd primer | TCAACTCAGGACTTGTTCTTACCT | |
| 21,796-21,817 | 57.4 | Rev primer | TGGTAGGACAGGGTTATCAAAC | ||
| 21,755-21,779 | 61.2 | Probe | HEX-TTCCATGCTATACATGTCTCTGGGA-BHQ1 | ||
| Yale_ORF1a-del | 11,229-11,248 | 60.0 | Fwd primer | TGCCTGCTAGTTGGGTGATG | |
| 11,332-11,356 | 57.8 | Rev primer | TGCTGTCATAAGGATTAGTAACACT | ||
| 11,283-11,312 | 61.9 | Probe | Cy5-GTTTGTCTGGTTTTAAGCTAAAAGACTGTG-BHQ2 |
- Positive control; Twist synthetic SARS-CoV-2 RNA controls at 100 copies/uL (control 2 = reference strain, control 14 = B.1.1.7)
Troubleshooting
RT-qPCR Protocol
Briefly vortex and centrifuge reagents before use.
Prepare 20 µM working stocks of the primers and probes, by adding 20 µL of 100 µM stock to 80 µL nuclease-free water.
Use the 20 µM working stocks to prepare primer-probe-water mix containing the following:
| A | B | C | |
| Component | Volume (1 reaction) | Volume (100 reactions) | |
| CDC_N1_F (200 nM/reaction) | 0.2 µL | 20 µL | |
| CDC_N1_R (200 nM/reaction) | 0.2 µL | 20 µL | |
| CDC_N1_P (100 nM/reaction) | 0.1 µL | 10 µL | |
| Yale_69/70del_F (400 nM/reaction) | 0.4 µL | 40 µL | |
| Yale_69/70del_R (400 nM/reaction) | 0.4 µL | 40 µL | |
| Yale_69/70del_P (200 nM/reaction) | 0.2 µL | 20 µL | |
| Yale_ORF1a-del_F (400 nM/reaction) | 0.4 µL | 40 µL | |
| Yale-ORF1a-del_R (400 nM/reaction) | 0.4 µL | 40 µL | |
| Yale-ORF1a-del_P (200 nM/reaction) | 0.2 µL | 20 µL | |
| Nuclease-free water | 1.5 µL | 150 µL |
NB: a larger volume of primer-probe-water mix can be prepared in advance, aliquoted in LightSafe microcentrifuge tubes, and stored at -20°C.
Diagram sample, standard, and control positions on a 96-well plate map.
- On ice, prepare a master mix containing the following (account for 10% extra lost during pipetting), except RNA:
| A | B | |
| Component | Volume in 20 µL reaction | |
| Tube label = MM | 10 µL | |
| Tube label = RT | 1 µL | |
| Tube label = primer-probe-water mix | 4 µL | |
| Viral RNA, positive control, or negative control | 5 µL (do not add to master mix) |
Add 15 µL of mastermix to each well (on ice).
Add 5 µL of positive control (Twist synthetic RNA control at 100 copies/µL) and no-template control (NTC - water) to the designated wells (on ice). Mix by pipetting (avoid bubbles).
Add 5 µL of viral RNA to the designated wells (on ice). Mix by pipetting (avoid bubbles).
Cover with plate sealer. Centrifuge to remove bubbles, if present.
Set the thermocycler to read FAM, HEX, and Cy5 fluorophores.
Run the following thermocycler conditions:
| A | B | C | |
| Step | Temperature | Time | |
| 1 | 55°C | 10 min | |
| 2 | 95°C | 1 min | |
| 3 | 95°C | 10 sec | |
| 4 | 55°C | 30 sec | |
| 5 | Read plate | ||
| Repeat steps 3-5 for 39 cycles. | |||
Interpreting results:
| A | B | C | D | |
| Result | CDC_N1 (FAM) | Yale_69/70del (HEX) | Yale_Orf1a-del (Cy5) | |
| Potentially B.1.1.7 | CT ≤ 35 | Undetected | Undetected | |
| Potentially B.1.351 or P.1 | CT ≤ 35 | CT ≤ 35 | Undetected | |
| Potentially B.1.375, B.1.258, or other lineages | CT ≤ 35 | Undetected | CT ≤ 35 | |
| Other lineages | CT ≤ 35 | CT ≤ 35 | CT ≤ 35 | |
| Inconclusive | CT > 35 or undetected | Any value | Any value |
NB: Thresholds were determined when testing the assay with the NEB Luna Universal Probe One-Step RT-qPCR kit on the Bio-Rad CFX96, and may be different when using other RT-qPCR kits or instruments.