Nov 26, 2024

Multiplexed CRISPR-based target-enriched next-generation sequencing for detecting antibiotic resistance genes in environmental samples V.2

Multiplexed CRISPR-based target-enriched next-generation sequencing for detecting antibiotic resistance genes in environmental samples
  • 1University of Illinois at Urbana-Champaign
Icon indicating open access to content
QR code linking to this content
Protocol CitationYuqing Mao, Thanh Nguyen 2024. Multiplexed CRISPR-based target-enriched next-generation sequencing for detecting antibiotic resistance genes in environmental samples. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5xdnjg1b/v2Version created by Yuqing Mao
Manuscript citation:
Yuqing Mao, Joanna L Shisler, Thanh H Nguyen (2024) Enhanced detection for antibiotic resistance genes in wastewater samples using a CRISPR-enriched metagenomic method.Water Research doi: 10.1016/j.watres.2024.123056
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 23, 2024
Last Modified: November 26, 2024
Protocol  Integer ID: 112660
Keywords: CRISPR, antibiotic resistance, next-generation sequencing, metagenomic, library, multiplex, ARG, antibiotic-resistance gene, Illumina, target enrichment, sequencing, environmental, wastewater, sewage, Cas9, NGS, antibiotic resistance genes in environmental sample, detecting antibiotic resistance gene, throughput detection of antibiotic resistance gene, metagenomic sequencing, multiplexed crispr, including metagenomic sequencing, higher sensitivity than regular metagenomic ngs method, antibiotic resistance gene, crispr, generation sequencing, regular metagenomic ngs method, abundance genetic marker, bacterial virulence factor, rna design, dna sample preparation, genetic marker, rna, gene
Funders Acknowledgements:
Water Research Foundation
Grant ID: 5182
USEPA
Grant ID: R840487
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
High-throughput detection of antibiotic resistance genes (ARGs) in complex environmental samples is challenging for two reasons: 1) ARGs account for less than 0.1% of total DNA in an environmental sample, and 2) it is difficult to detect thousands of ARGs in one reaction. Conventional methods, including metagenomic sequencing and quantitative polymerase chain reaction (qPCR), have their limitations with sensitivity and target range, respectively. Here, we propose a multiplexed CRISPR-Cas9-based target-enriched next-generation sequencing (NGS) method to detect thousands of ARGs in complex environmental samples, using sewage as a testbed. This protocol includes guide RNA design, guide RNA synthesis, DNA sample preparation, CRISPR-NGS library preparation, and data processing steps. With this protocol, ARGs in low abundances can be detected with increased read depth and higher sensitivity than regular metagenomic NGS methods. This protocol is also applicable for detecting other low-abundance genetic markers, for example, bacterial virulence factors, in environmental samples.
Materials
Equipment
1. PCR thermal cycler
2. Qubit fluorometer
3. Microcentrifuge
4. Magnetic separation rack for 0.2 mL tubes
5. Pipettes, 0.5 - 10 μL, 2 - 20 μL, 20 - 200 μL, 100 - 1000 μL, adjustable volume
6. Bead beater or vortex with bead-beating adapters

Consumables
1. Nuclease-free 1.5 mL microcentrifuge tubes
2. Nuclease-free 0.2 mL PCR tubes
3. Nuclease-free 1000 μL pipette tips with filter
4. Nuclease-free 200 μL pipette tips with filter
5. Nuclease-free 20 μL pipette tips with filter
6. Nuclease-free 10 μL pipette tips with filter
7. MF-Millipore Membrane Filter, 0.45 µm pore size (Millipore, Catalog #: HAWP04700)
8. Qubit Assay Tubes

Buffers and chemicals 1. Molecular biology grade water
2. Nuclease-Free Duplex Buffer (Integrated DNA Technologies, Catalog #: 11-05-01-03/11-01-03-01/11-05-01-12)
3. 100% Ethanol, molecular biology grade
4. NEBuffer r3.1 (New England Biolabs, Catalog #: B6003S)
5. dATP Solution (100 mM) (Thermo Scientific, Catalog #: R0141)
6. xGen Adapter Buffer, 300 mL (Integrated DNA Technologies, Catalog #: 10006743)
7. TE buffer
8. AMPure XP SPRI Reagent (Beckman Coulter, Catalog #: A63880/ A63881/ A63882)
Kits and master mixes 1. Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs, Catalog #: M0531L)
2. TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, Catalog #: K0441)
3. RNA Clean & Concentrator-5 (DNase I included) (Zymo, Catalog #: R1013/R1014)
4. Qubit RNA Broad Range (BR) Assay Kit (Invitrogen, Catalog #: Q10210/Q10211)
5. FastDNA SPIN Kit for Soil (MP Biomedicals, Catalog #: 116560200/116560300)
6. OneStep PCR Inhibitor Removal Kit (Zymo, Catalog #: D6030)
7. Qubit 1X dsDNA High Sensitivity (HS) Assay Kit (Invitrogen, Catalog #: Q33230/Q33231)
8. NEBNext Ultra II Ligation Module (New England Biolabs, Catalog #: E7595S/ E7595L)
9. NEBNext Ultra II Q5 Master Mix (New England Biolabs, Catalog #: M0544S/M0544L/M0544X)
Nucleic acids
1. Double-stranded DNA template for tracrRNA (5’-AGGCGAATCAGATAATCGTTATGTCCAGACTGTATTAATACGACTCACTATAGGACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT-3’), dissolve in molecular biology grade water to reach a final concentration of 1 ng/μL (Quan et al., 2019).
2. DNA oligo pool as the template for crRNA (5’-TAATACGACTCACTATAGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTATGCTGTTTTG-3’) (replace the XXXXXXXXXXXXXXXXXXXX part by the designed multiplex sequences), dissolve and dilute in molecular biology grade water to reach a final concentration of 10 ng/μL (see the Equation below) (Quan et al., 2019).
3. Primers for DNA template PCR amplification: (Forward primer for both crRNA and tracrRNA: 5’-TAATACGACTCACTATAG-3’; Reverse primer for crRNA: 5’-CAAAACAGCATAGCTCTAAAAC-3’; Reverse primer for tracrRNA: 5’-AAAAGCACCGACTCGGTGCCAC-3’), dissolve in molecular biology grade water to reach a final concentration of 10 μM (Liang et al., 2015).
4. Double-stranded DNA with 5’ phosphorylation “NH8B” as the external standard spike (5’- ACCCATACAAGGAACCCGGCCAGCACTACGCTCACTACGGCCGGTGGTACGGTGGGCACTCCGGTGAAATGCACGTGCTTGGCATGCCGTCAGGCCGTGAAGTCAAGCGCACCCCGGTGTTCAACATGGACAGCAACAAGATGACCATCCACATCGCCTCGCCGGCGCCGGCATACAGTCTGGGGGGAATTCAAGATGGAGAAGGGCGACGAGGTAATGGCGATCCTGACCTCGACAAGTGGAAGACCTG-3’), dissolve in molecular biology grade water to reach a final concentration of 10 ng/μL (Zhang & Ishii, 2018).
5. xGen UDI-UMI Adapters (Integrated DNA Technologies, Catalog #: 10006914/ 10005903)
6. xGen Library Amplification Primer Mix (Integrated DNA Technologies, Catalog #: 1077675/1077676/1077677)

Proteins
1. Alt-R S.p. HiFi Cas9 Nuclease V3 (Integrated DNA Technologies, Catalog #: 1081060/1081061/10007803)
2. rAPid Alkaline Phosphatase (Roche, Catalog #: 4898133001/ 4898141001)
3. RNase A, DNase and protease-free (10 mg/mL) (Thermo Scientific, Catalog #: EN0531)
4. Thermolabile Proteinase K (New England Biolabs, Catalog #: P8111S)
5. Taq DNA Polymerase with Standard Taq Buffer (New England Biolabs, Catalog #: M0273S/M0273L/M0273X/M0273E)

Equation: DNA oligo pool total mass calculation

Citation
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED (2019). FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
LINK

Citation
Liang X, Potter J, Kumar S, Zou Y, Quintanilla R, Sridharan M, Carte J, Chen W, Roark N, Ranganathan S, Ravinder N, Chesnut JD (2015). Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.
LINK

Citation
Zhang Q, Ishii S (2018). Improved simultaneous quantification of multiple waterborne pathogens and fecal indicator bacteria with the use of a sample process control.
LINK

Before start
It is highly recommended to use DNA Away and RNase Away to clean all surfaces and equipment before wet lab experiments.
Multiplex crRNA design (using FLASHit as an example)
Create a Linux environment. It can be set up in MobaXterm (https://mobaxterm.mobatek.net/) or other preferred terminal software. Using MobaXterm as an example, the Linux environment can be created by “Sessions” -> “New session” -> WSL. Then, select “Ubuntu” for “Distribution”. Click on “OK”, and the session will be created and saved.
10m
Install FLASHit (https://github.com/czbiohub-sf/flash) in the Linux environment according to the instructions in “Prerequisite” on its GitHub webpage.
Citation
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED (2019). FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
LINK

1h
Collect all target genes from databases. Here, as an example, all available sequences for antibiotic resistance genes (ARGs) from The Comprehensive Antibiotic Resistance Database (CARD) (https://card.mcmaster.ca/) were downloaded using the link: https://card.mcmaster.ca/latest/data.
Citation
Alcock BP, Huynh W, Chalil R, Smith KW, Raphenya AR, Wlodarski MA, Edalatmand A, Petkau A, Syed SA, Tsang KK, Baker SJC, Dave M, McCarthy MC, Mukiri KM, Nasir JA, Golbon B, Imtiaz H, Jiang X, Kaur K, Kwong M, Liang ZC, Niu KC, Shan P, Yang JYJ, Gray KL, Hoad GR, Jia B, Bhando T, Carfrae LA, Farha MA, French S, Gordzevich R, Rachwalski K, Tu MM, Bordeleau E, Dooley D, Griffiths E, Zubyk HL, Brown ED, Maguire F, Beiko RG, Hsiao WWL, Brinkman FSL, Van Domselaar G, McArthur AG (2023). CARD 2023: expanded curation, support for machine learning, and resistome prediction at the Comprehensive Antibiotic Resistance Database.
LINK

10m
For an ARG detection project, among all downloaded “.fasta” files, “nucleotide_fasta_protein_homolog_model.fasta” was used as the input, because the ARGs that have raised high concerns such as the CTX-M gene families and the mcr gene families are included in the protein homolog model.
Trim the “nucleotide_fasta_protein_homolog_model.fasta” file using the Python code below to keep only the antibiotic resistance ontology (ARO) of the ARGs in the titles, because special characters cannot be processed by FLASHit.
Command
new command name
import re

file=open(r"INPUT_FASTA_FILE_PATH_HERE")
raw_content=file.readlines()
file.close()

output_content=[]

for i in range(0,len(raw_content)):
    if i%2==0:
        aro_number=re.findall(r'ARO:[0-9]+',raw_content[i])[0]
        output_content.append('>'+aro_number.split(':')[1])
    if i%2!=0:
        output_content.append(raw_content[i].strip('\n'))

output_file=open(r" OUTPUT_TRIMMED_FASTA_FILE_PATH_HERE ",'w')

for i in range(0,len(output_content)):
    output_file.write(output_content[i]+'\n')

output_file.close()

Note
For DNA sequences downloaded from other databases, the above code may need to be modified. Each ARG has its own corresponding ARO in CARD.


10m
In Linux terminal, activate the conda environment, then activate the environment for running FLASHit.
1m
[optional] By default, FLASHit excludes the off-target sites from human genomes and the E. coli BL21 genome. If an environmental sample is expected to include undesired genomes other than these two, for example, swine genomes, users can modify the files in /flash/generated_files/ accordingly.
5h
Search the reference genome of the undesired off-targets from NCBI Genome database (https://www.ncbi.nlm.nih.gov/datasets/genome/) by typing the species name in the search box.
From the search results, click on the genome with theNCBI RefSeq label.
Download the genome sequence by choosing “RefSeq only” and “Genome sequences (FASTA)”.
Use each “.fasta” file as an input to FLASHit following the guidance in “Creating your own library” in the“Workflow” section on the GitHub page of FLASHit.
After “Will discard xxx targets in amibiguous_targets.txt affecting xxx not necessarily unique genes.” is shown on the screen, break the current FLASHit run by hitting Ctrl+C.
Go to the directory /flash/generated_files/target_index/, copy “all_targets.txt” to a customized directory, and rename it by the input “.fasta” file name.
After collecting and renaming all “all_targets.txt” files to the customized directory, split files larger than 10 Mb to separated 10 Mb files into a new directory using the command below.
Command
new command name
split -b 10m INPUT_FILE_NAME OUTPUT_FILE_PATH_AND_PREFIX

Note
Make sure the directory only contains split files, otherwise the other files will be also renamed.

In the new directory containing all split files, add “.txt” suffix to all files using the command below.
Command
new command name
ls | while read i; do mv ${i} ${i}.txt

Note
Make sure the directory only contains split files. Otherwise, the other files will be also renamed.

Copy and paste the other files smaller than 10 Mb to the directory containing all split files.
Run the following python code to remove replicated off-targets and organize all off-targets to the same file.
Command
new command name
import argparse
import os

parser = argparse.ArgumentParser()
parser.add_argument('-i',dest='input',type=str,required=True,help='Define input txt folder')
parser.add_argument('-o',dest='output',type=str,required=True,help="Define output path for a combined txt")
args=parser.parse_args()

full_gRNA_list=[]
dir_path=args.input.strip("'")
dir_list=os.listdir(dir_path)
for file_name in dir_list:
    print('Processing '+file_name+' ......')
    file=open(dir_path+'/'+file_name)
    raw_content=file.readlines()
    file.close()
    for i in range(0,len(raw_content)):
        raw_content[i]=raw_content[i].strip('\t\n\r')
    for i in range(0,len(raw_content),3):
        full_gRNA_list.append(raw_content[i])

full_gRNA_list=list(set(full_gRNA_list))

output_file=open(args.output.strip("'"),"w")
for i in range(0,len(full_gRNA_list)):
    output_file.write(full_gRNA_list[i]+'\n')
output_file.close()


Note
This code is written to be run by a command line. Users should save it as a “.py” file, and run it by typing “python3 NAME_OF_THE_PYTHON_CODE.py -i THE_DIRECTORY_PATH_CONTAINING_ALL_SPLIT_TXT_FILES -o THE_TXT_FILE_PATH_FOR_THE_OUTPUT_ORGANIZED_TARGET_LIST.txt”, quotation marks not included. In addition, this code may require a large memory, especially when the input genome is large. To avoid a potential crash, it is recommended to run this code on a server, instead of a personal computer.

If there are multiple off-target genomes, place all output “.txt” files generated by the above code into the same directory. The list for human genome off-targets is already provided by FLASHit with the file path "/flash/generated_files/human_guides_38.txt". Combine all off-targets into the same “all_offtargets.txt” file using the following Python code.
Command
new command name
import argparse

parser = argparse.ArgumentParser()
parser.add_argument('-i',dest='input',type=str,required=True,help='Define input txt folder')
parser.add_argument('-o',dest='output',type=str,required=True,help="Define output path for a combined txt")
args=parser.parse_args()

file=open(args.input.strip("'"))
gRNA_list=file.readlines()
file.close()

output_list=sorted(list(set(gRNA_list)))
output_file=open(args.output.strip("'"),'w')
for i in range(0,len(output_list)):
    output_file.write(output_list[i])
output_file.close()

Note
This code is also written to be run by a command line. Users should save it as a “.py” file and run it.
Replace the “all_offtargets.txt” file in “/flash/generated_files/” with the new “.txt” file generated by the code above. Make sure to rename the newly generated “.txt” file to “all_offtargets.txt”.
Rename “human_guides_38.txt” and “ecoli_bl21_de3_offtargets.txt” in “/flash/generated_files/” to “human_guides_38.txt1” and “ecoli_bl21_de3_offtargets.txt1” to avoid those two files to be identified by FLASHit by default.
Follow the guidance in “Creating your own library” in “Workflow” section on the GitHub page of FLASHit to generate a list for the multiplexed 20-nt target regions for the template of crRNA.
10m
Follow the guidance in “Creating a bed file of the guides” on the GitHub page of FLASHit to generate a file showing the cleavage sites of the crRNA on the target genes.
10m
Assemble the full crRNA templates by replacing the XXXXXXXXXXXXXXXXXXXX in 5’-TAATACGACTCACTATAGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTATGCTGTTTTG-3’ by the 20-nt sequences generated by FLASHit.
10m
The assembled nucleotide sequences can be used for purchasing DNA oligo pools.
Guide RNA preparation
6h 57m
Mix the DNA template for either crRNA or tracrRNA, forward and corresponding
reverse primers, Phusion High-Fidelity PCR Master Mix, and molecular biology
grade water in a nuclease-free PCR tube following the volumes listed in the
table below. Pipette up and down 10 times or until well mixed.
AB
Reagent Volume (μL)
DNA template 4
Forward primer (10 μM) 2.5
Reverse primer (10 μM) 2.5
Phusion High-Fidelity PCR Master Mix 25
Molecular biology grade water 16
Total 50

10m
Amplify the DNA templates for crRNA and tracrRNA in a thermal cycler for PCR. The steps in the thermal cycle are listed below.
ABCD
Step Temperature () Time (s) Cycles
Initial denaturation 98 ℃ 10 1x
Denaturation 98 ℃ 5 12x for tracr; 5x for cr
Annealing 55 ℃ 15
Final extension 72 ℃ 60 1x
Hold 4 ℃ 1x

Citation
Liang X, Potter J, Kumar S, Zou Y, Quintanilla R, Sridharan M, Carte J, Chen W, Roark N, Ranganathan S, Ravinder N, Chesnut JD (2015). Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.
LINK

30m
Mix ATP, UTP, GTP, and CTP provided in TranscriptAid T7 High Yield Transcription Kit in 1:1:1:1 ratio in a nuclease-free microcentrifuge tube. Pipette up and down for 10 times or until well mixed.
10m
For the transcription reaction of crRNA and tracrRNA, mix the reagents from TranscriptAid T7 High Yield Transcription Kit and the PCR-amplified DNA templates in nuclease-free PCR tubes following the volumes provided in the table below. Pipette up and down 10 times or until well mixed. A 50-μL PCR-amplified DNA template can be divided into 4 transcription reactions in this step.
AB
Reagent Volume (μL)
Mixed NTP 16
PCR-amplified DNA template 12
5X TranscriptAid Reaction Buffer 8
TranscriptAid Enzyme Mix 4
Total 40

Note
The reagents must be added following the order from the top to the bottom in the above table.

Citation
Liang X, Potter J, Kumar S, Zou Y, Quintanilla R, Sridharan M, Carte J, Chen W, Roark N, Ranganathan S, Ravinder N, Chesnut JD (2015). Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.
LINK

10m
Incubate the RNA transcription samples at 37 ℃ for 4-6 hours.
Note
A white mist should be visible for a successful reaction after incubation. Adjust reaction time accordingly.

4h
Add 5 μL of DNase I (1 U/μL) and 5 μL of DNA Digestion Buffer provided in RNA Clean & Concentrator-5 (DNase I included) to each 40-μL RNA transcription reaction. Pipette up and down 10 times or until well mixed.
10m
Incubate at room temperature for 30 min.
30m
Follow the “Total RNA Clean-up” instructions in the user manual of RNA Clean & Concentrator-5. Use 15 μL of DNase/RNase-Free Water to elute the purified crRNA or tracrRNA product. Incubate for 5 min before the final centrifugation to ensure maximum yield.

Note
Use 1.5 volumes of ethanol to reach maximum RNA yield as suggested in the manual for 17-200 nt RNA, in the case of 40 μL transcription with 5 μL of DNase I and 5 μL of DNA Digestion Buffer added, use 225 μL of 100% ethanol. Highly recommend using low-retention pipette tips to ensure maximum RNA yield.

30m
Pipette each purified crRNA or tracrRNA product up and down for 10 times or until well mixed. Take 1 μL from each purified RNA sample, dilute 100-fold in 99 μL of molecular biology grade water. Pipette up and down for 10 times or until well mixed. Quantify each 100-fold-diluted purified crRNA or tracrRNA using QubitRNA Broad Range (BR) Assay Kit by adding 10 μL diluted sample to 190 μL of master mix.
the
Note
This is not just a QC step. It is necessary to determine the concentration for each crRNA and tracrRNA for calculating themixing ratio before making duplexed guide RNA. Usually, the final concentrations for crRNA are >2,000 ng/μL, and the final concentrations for tracrRNA are > 4,000 ng/μL.

20m
Aliquot the crRNA and tracrRNA samples and store at -80 ℃ before use.
10m
Right before making CRISPR-NGS library, mix crRNA and tracrRNA in anequi-molar ratio (see Equation 1), then add Nuclease-Free Duplex Buffer to reach a final guide RNA concentration of 2500 ng/μL (see Equation 2). Pipette up and down 10 times or until well mixed.

Equation 1: crRNA and tracrRNA equi-molar ratio mixing

Equation 2: Volume calculation for crRNA and tracrRNA mixing

10m
Incubate the mixture in a thermal cycler at 94 ℃ for 2 min, then slowly cool down to room temperature. The guide RNA is ready to use.
7m
DNA sample preparation (Sewage sample as an example)
Shake the sewage sample until well mixed, and filter 50 mL of the sewage sample through 0.45 μm pore size membrane filter.
Note
The volume is determined by the turbidity of the sewage sample. For extremely turbid sewage samples, the volume can go down to 10-20 mL, and for relatively clear samples, the volume can go up to 100 or 200 mL until the filter is clogged.

1h
Store the membrane filter at -80 ℃ until DNA extraction.
Note
The filters can be cut into two before storage. Usually, half of a filter can obtain a high enough DNA yield.

Extract DNA from the membrane filter using FastDNA SPIN Kit for Soil following the user’s manual. Elute the DNA samples using 100 μL of DES provided in the kit.
2h
Purify the DNA samples using OneStep PCR Inhibitor Removal Kit following the user’s manual.
10m
Determine the concentrations of the DNA samples using Qubit 1X dsDNA High Sensitivity (HS) Assay Kit by adding 2 μL diluted sample to 198 μL of master mix.
Note
Usually, the DNA concentrations are higher than 10 ng/μL.

15m
Aliquot and store the DNA samples at -20 ℃ or -80 ℃ until library preparation.
CRISPR-NGS library preparation
Pre-mix Cas9 nuclease (25 μM) and the duplexed gRNA (2500 ng/μL) obtained from step 23 in 3:10 volume ratio. Incubate at room temperature for 2.5 hr.
Serial dilute the “NH8B” external standard 1000-fold using molecular biology grade water. Keep the 100-fold diluted standard for Qubit quantification.
5m
Determine the concentration of the 100-fold diluted “NH8B” external standard using Qubit 1X dsDNA High Sensitivity (HS) Assay Kit by adding 5 μL diluted external standard to 195 μL of master mix.
10m
Block the DNA samples by removing 5’ phosphate group using rAPid Alkaline Phosphatase with the volumes listed in the table below.
AB
Reagent Amount
rAPid Alkaline Phosphatase Buffer 10x concentrated 2 μL
rAPid Alkaline Phosphatase 1 U/μl 1 μL
DNA sample ~200 ng
Molecular biology grade water Fill up the volume to 20 μL

Note
You can reduce the volume to 10 μL if the DNA sample is limited. In such cases, the DNA sample input will be ~ 100 ng, and the volumes of the buffer and the phosphatase will be reduced to half of the volumes listed above.

Citation
Gilpatrick T, Lee I, Graham JE, Raimondeau E, Bowen R, Heron A, Downs B, Sukumar S, Sedlazeck FJ, Timp W (2020). Targeted nanopore sequencing with Cas9-guided adapter ligation.
LINK

Citation
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED (2019). FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
LINK

10m
Incubate the DNA-blocking reaction mixture in a thermal cycler with the following thermal conditions.
ABC
Step Temperature () Time (min)
Incubation 37 10
Phosphatase inactivation 75 2
Hold 4

15m
Mix the Cas9-gRNA premix, blocked DNA sample, NH8B positive control, NEBuffer r3.1, and molecular biology grade water in nuclease-free PCR tubes with the volumes listed in the table below. Pipette up and down 10 times or until well mixed.

AB
ReagentVolume (μL)
Blocked DNA sample6-8
NEBuffer r3.13
NH8B positive control (1000x diluted)1
Cas9-gRNA premix10.4
Molecular biology grade water7.6-9.6
Total30

Citation
Liu Y, Tao W, Wen S, Li Z, Yang A, Deng Z, Sun Y (2015). In Vitro CRISPR/Cas9 System for Efficient Targeted DNA Editing.
LINK

10m
Incubate the above mixture at 37 ℃ for 16 hours.
16h
Add 2.5 μL of RNase A to the mixture, pipette up and down for 10 times, and incubate at room temperature for 15 min to remove gRNA.
15m
Add 2.5 μL of Thermolabile Proteinase K to the mixture, pipette up and down for 10 times, and incubate in a PCR machine using the following thermal cycle:


AB
Temperature (℃)Time (min)
3715
5510

Prepare the master mix for dA-tailing, using the reagents and volumes listed in the table below. Pipette up and down 10 times or until well mixed.
AB
Reagent Volume (μL)
dATP (100 mM) 2
Taq DNA Polymerase 5
Standard Taq Buffer 80
Molecular biology grade water 13
Total 100

Citation
Gilpatrick T, Lee I, Graham JE, Raimondeau E, Bowen R, Heron A, Downs B, Sukumar S, Sedlazeck FJ, Timp W (2020). Targeted nanopore sequencing with Cas9-guided adapter ligation.
LINK

10m
Add 5 μL of the dA-tailing master mix to each 35-μL mixture to reach a 40 μL total volume. Pipette up and down 10 times or until well mixed.
5m
Incubate the mixture at 72 ℃ for 20 min for dA-tailing.
20m
Dilute adapters 100-fold using molecular biology grade water or xGen Adapter Buffer.
Note
Highly recommend using UDI-UMI adapters with unique molecular barcoding to reduce the biases caused by PCR.

10m
Ligate adapters to targeted DNA fragments using the reagents and volumes listed in the table below.
AB
Reagent Volume (μL)
dA-tailed DNA sample 35
Diluted adapter 2
NEBNext Ligation Enhancer 1
NEBNext Ultra II Ligation Master Mix 30
Total 68

Note
The reagents must be added following the order from the top to the bottom in the above table. After adding each reagent, pipette up and down 10 times or until well mixed. The ligation master mix should be well mixed before adding to the reaction.

10m
Incubate the ligation mixture at room temperature for 15 min.
15m
Dilute 1x TE buffer 10-fold to make 0.1x TE buffer.
5m
Purify the adapter-ligated DNA samples using AMPure XP SPRI beads with beads:DNA ratio of 0.8:1 (57 μL of SPRI beads for 68 μL of adapter-ligated DNA sample). The detailed SPRI beads cleaning steps are listed in the table below.
ABC
Step On/Off the magnetic rack Time (min)
Bind DNA sample to the beads off 5
Separate the beads from the liquid phase on 5
Discard the supernatant on /
1st wash with 80% ethanol on 0.5
Discard the supernatant on /
2nd wash with 80% ethanol on 0.5
Discard the supernatant on /
Air dry the beads with the lid open on 3-5
Resuspend the beads with 17 μL of 0.1x TE buffer off /
Release DNA from the beads to the liquid phase off 15
Separate the beads from the liquid phase on 5
Transfer 15 μL of the supernatant to a clean PCR tube on /

1h
Dilute the xGen Library Amplification Primer Mix 2-fold by adding an equal volume of molecular biology grade water.
5m
Mix the beads-purified DNA sample, diluted primer mix, and NEBNextUltra II Q5 Master Mix in a nuclease-free PCR tube according to the table below. Pipette up and down 10 times or until well mixed.
AB
Reagent Volume (μL)
Beads-purified DNA sample 15
Diluted primer mix 10
NEBNext Ultra II Q5 Master Mix 25
Total 50

5m
Incubate the mixture above in a thermal cycler using the thermal cycle listed in the table below.
ABCD
Step Temperature () Time Cycles
Initial denaturation 98 ℃ 30 s 1x
Denaturation 98 ℃ 10 s 22x
Annealing 65 ℃ 75 s
Final extension 65 ℃ 5 min 1x
Hold 4 ℃ 1x

1h
0.50Purify the PCR product using AMPure XP SPRI beads with beads:DNA ratio of 0.9:1 (45 μL of SPRI beads for 50 μL of PCR product). The detailed SPRI beads cleaning steps are listed in the table below.
ABC
Step On/Off the magnetic rack Time (min)
Bind the PCR product to the beads off 5
Separate the beads from the liquid phase on 5
Discard the supernatant on /
1st wash with 80% ethanol on 0.5
Discard the supernatant on /
2nd wash with 80% ethanol on 0.5
Discard the supernatant on /
Air dry the beads with the lid open on 3-5
Resuspend the beads with 33 μL of 0.1x TE buffer off /
Release DNA from the beads to the liquid phase off 15
Separate the beads from the liquid phase on 5
Transfer 30 μL of the supernatant to a clean tube on /

1h
Determine the DNA concentration of the library using Qubit 1X dsDNA High Sensitivity (HS) Assay Kit by adding 2 μL diluted external standard to 198 μL of master mix.
Note
The DNA concentration should be above 2 ng/μL for a successful library.

10m
According to the DNA concentration, take 1-2 μL of the library and dilute to ~1 ng/μL for fragment analysis.
Note
A visible peak at ~170 bp means excess adapter dimers. After pooling and before sequencing, such libraries should be size selected using SPRI beads or eGel.

4h
Store the libraries at -20 ℃ or -80 ℃ until the sequencing run.
For sequencing, we recommend doing 2x150 nt with a total number of reads of at least 25 million for each library.
NGS read mapping
4h 41m
Download and install PRICE from https://derisilab.ucsf.edu/software/price/index.html to the local Linux environment.
Citation
Ruby JG, Bellare P, Derisi JL (2013). PRICE: software for the targeted assembly of components of (Meta) genomic sequence data.
LINK

10m
Download and install Bowtie2 from Bioconda https://anaconda.org/bioconda/bowtie2 to the local Linux environment.
Citation
Langmead B, Salzberg SL (2012). Fast gapped-read alignment with Bowtie 2.
LINK

Download and install UMI-tools from https://github.com/CGATOxford/UMI-tools to the local Linux environment.
Citation
Smith T, Heger A, Sudbery I (2017). UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy.
LINK

Download and install SAMtools from https://github.com/samtools/samtools to the local Linux environment.
Citation
Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H (2021). Twelve years of SAMtools and BCFtools.
LINK

After sequencing, download all raw sequencing fastq.gz files.
2h
The read1, read2, and UMI should be stored in three different fastq.gz files. If only read1 and read2 files are available, use Trimmomatic (http://www.usadellab.org/cms/index.php?page=trimmomatic) to separate UMI into a third fastq.gz file.
Command
new command name
java -jar PATH_TO/trimmomatic-0.39.jar SE --threads n input_read1_or_2.fastq.gz output_UMI.fastq.gz HEADCROP:8

Citation
Bolger AM, Lohse M, Usadel B (2014). Trimmomatic: a flexible trimmer for Illumina sequence data.
LINK

1h
Unzip all fastq.gz files to fastq files.
Sort all fastq files using the command below, to ensure all reads are in the same order in read1, read2, and UMI files.
Command
new command name
cat file.fastq | paste - - - - | sort -k1,1 -t " " | tr "\t" "\n" > file_sorted.fastq

Note
Sometimes the reads in different fastq files are already in the same order. This can be checked quickly by using the "head" command for each fastq file. If the sequence identifiers that begin with the "@" character in lines 1, 5, and 9 are in the same order in read1, read2, and UMI fastq files for the same library, this sorting step can be skipped.

Extract UMI for read1 and read2 files using the following command.
Command
new command name
umi_tools extract --extract-method=string --bc-pattern=NNNNNNNNN -I [UMI_index_fastq_file] -S [UMI_index_fastq_file_out_nothing_left] --read2-in=[read_fastq_file_to_add_UMI] --read2-out=[output_read_fastq_file_with_UMI_added]

Note
Please note that the read2 in the UMI-tools command is not the read2 fastq file obtained from sequencing. This command should be run twice to add UMI into read1 and read2 files respectively. In each run, either the read1 or the read2 file name should be entered after "--read2-in="
The UMI.fastq file will no longer be used in the following steps after being added to the read1 and read2 files.

Screen the low-quality sequencing reads using PriceSeqFilter with 85% of nucleotides in a read must be in high quality, the minimum allowed probability of a nucleotide being correct is 98%, and 90% of nucleotides in a read that must be called. An example of the command for paired sequences is shown below.
Command
new command name
PATH_TO_PRICE_FOLDER/Price/PriceSeqFilter -fp R1.fastq R2.fastq -rqf 85 0.98 -rnf 90 -op R1_filtered.fastq R2_filtered.fastq

Citation
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED (2019). FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
LINK

1h
Make a copy of the ".fasta" file used for generating guide RNA in Step 8. Add the sequence of the "NH8B" external standard to the end of the copied file. This ".fasta" file will be used as a reference gene list for read mapping.

Note
Copy and paste the entire content below to the .fasta file:

>NH8B
ACCCATACAAGGAACCCGGCCAGCACTACGCTCACTACGGCCGGTGGTACGGTGGGCACTCCGGTGAAATGCACGTGCTTGGCATGCCGTCAGGCCGTGAAGTCAAGCGCACCCCGGTGTTCAACATGGACAGCAACAAGATGACCATCCACATCGCCTCGCCGGCGCCGGCATACAGTCTGGGGGGAATTCAAGATGGAGAAGGGCGACGAGGTAATGGCGATCCTGACCTCGACAAGTGGAAGACCTG

Citation
Zhang Q, Ishii S (2018). Improved simultaneous quantification of multiple waterborne pathogens and fecal indicator bacteria with the use of a sample process control.
LINK

1m
Index the ".fasta" file for Bowtie2 mapping.
Command
new command name
bowtie2-build reference.fasta reference

Map the sequencing reads to the reference using Bowtie2 and generate a sorted bam file using SAMtools. The unaligned reads are excluded from the output.
Command
new command name
bowtie2 -x reference -1 R1_with_UMI.fastq -2 R2_with_UMI.fastq -a --very-sensitive --threads n | samtools view -bSF4 - | samtools sort - -o sorted_output.bam -@ n

Index the bam file obtained from step 67 using SAMtools.
Command
new command name
samtools index sorted_output.bam -@ n   

Deduplicate the reads in the bam file obtained in step 67 using UMI-tools.
Command
new command name
umi_tools dedup -I input.bam --output-stats=deduplicated -S deduplicated.bam

Sort and index the deduplicated bam file using SAMtools.
Command
new command name
samtools sort deduplicated.bam -o deduplicated_sorted.bam -@ n
samtools index deduplicated_sorted.bam -@ n  

Note
The bam and bai files generated in this step can be viewed in Integrative Genomics Viewer (IGV).

Citation
Thorvaldsdóttir H, Robinson JT, Mesirov JP (2013). Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.
LINK

Get the coverage for the ARGs detected in the library using SAMtools. Use "--ff 0" to remove the restriction of secondary alignment.
Command
new command name
samtools coverage --ff 0 -o coverage_out.tsv deduplicated_sorted.bam

Organize coverage files by adding ARG names and combine into one single xlsx file using the following Python code. The coverage threshold is set to 75% in this code. The reference file is ARO_index.tsv downloaded from the Comprehensive Antibiotic Resistance Database (CARD). The xlsx file is the final output of this pipeline.
Command
new command name
import pandas as pd
import os
import argparse

parser = argparse.ArgumentParser()
parser.add_argument('-i',dest='input',type=str,required=True,help='Define input tsv folder')
parser.add_argument('-r',dest='reference',type=str,required=True,help='Define input reference file')
parser.add_argument('-o',dest='output',type=str,required=True,help="Define output path for a combined excel with ARG names and drug classes")
args=parser.parse_args()

ARO_table=pd.read_csv(args.reference,sep='\t')

dir_path=args.input.strip("'")
dir_list=os.listdir(dir_path)
dir_list=sorted(dir_list)
for file_name in dir_list:
    if file_name.endswith('.tsv'):
        print(file_name)
        prefix=file_name.split('.tsv')[0]        
        mapping_table=pd.read_csv(dir_path+'/'+file_name,sep='\t')
        mapping_table['ARG_name']=''
        mapping_table['ARG_family']=''
        mapping_table['Drug_class']=''
        
        for i in range(0,len(mapping_table)):
            if mapping_table.loc[i,'numreads']==0:
                continue
            else:
                for j in range(0,len(ARO_table)):
                    if str(mapping_table.loc[i,'#rname']).strip('\t ') in ARO_table.loc[j,'ARO Accession']:
                        mapping_table.loc[i,'ARG_name']=ARO_table.loc[j,'CARD Short Name']
                        mapping_table.loc[i,'Drug_class']=ARO_table.loc[j,'Drug Class']
                        mapping_table.loc[i,'ARG_family']=ARO_table.loc[j,'AMR Gene Family']
                        break
        
        output_table=pd.DataFrame(columns=mapping_table.columns)
        for i in range(0,len(mapping_table)):
            if mapping_table.loc[i,'coverage']>=75:
                output_table=output_table.append(mapping_table.loc[i],ignore_index=True)
             
    if os.path.exists(args.output):
        with pd.ExcelWriter(args.output, mode='a') as writer:  
            output_table.to_excel(writer, sheet_name=prefix) 
    else:
        output_table.to_excel(args.output,sheet_name=prefix) 

Citation
Alcock BP, Huynh W, Chalil R, Smith KW, Raphenya AR, Wlodarski MA, Edalatmand A, Petkau A, Syed SA, Tsang KK, Baker SJC, Dave M, McCarthy MC, Mukiri KM, Nasir JA, Golbon B, Imtiaz H, Jiang X, Kaur K, Kwong M, Liang ZC, Niu KC, Shan P, Yang JYJ, Gray KL, Hoad GR, Jia B, Bhando T, Carfrae LA, Farha MA, French S, Gordzevich R, Rachwalski K, Tu MM, Bordeleau E, Dooley D, Griffiths E, Zubyk HL, Brown ED, Maguire F, Beiko RG, Hsiao WWL, Brinkman FSL, Van Domselaar G, McArthur AG (2023). CARD 2023: expanded curation, support for machine learning, and resistome prediction at the Comprehensive Antibiotic Resistance Database.
LINK

Trouble shooting
The DNA fragments in the final libraries don't have a peak at ~370-420 bp.
Note
We highly recommend saving the 5 μL dA-tailed leftover sample after taking 35 μL out for adapter ligation in step 43. The 5 μL leftover can be used for gel electrophoresis to check the Cas9 cleavage outcome. We recommend using 3% agarose gel for size check. If the peak of the DNA fragments in the leftover samples is at ~100-150 bp, it usually suggests a DNase residue in crRNA or tracrRNA. Kits like DNase Alert can be used to check this DNase residue. To avoid this residue, the concentration of DNase I used in step 17 should be strictly controlled at 1 U/μL.

DNA concentration of the final library is lower than 2 ng/μL.
Note
Make sure to dilute the adapters right before ligation. Storing adapters at -20 ℃ with a low concentration may cause degradation.

The yield of crRNA/tracrRNA is low.
Note
Elongate the transcription time by 30 min and check the formation of white mist, but don't incubate for longer than 8 hours. Make sure to use 1.5 volumes of 100% ethanol when binding the RNA to the spin column. Check the DNA template concentration after PCR in step 13.

Citations
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED. FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
https://doi.org/10.1093/nar/gkz418
Liang X, Potter J, Kumar S, Zou Y, Quintanilla R, Sridharan M, Carte J, Chen W, Roark N, Ranganathan S, Ravinder N, Chesnut JD. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.
https://doi.org/10.1016/j.jbiotec.2015.04.024
Zhang Q, Ishii S. Improved simultaneous quantification of multiple waterborne pathogens and fecal indicator bacteria with the use of a sample process control.
https://doi.org/10.1016/j.watres.2018.03.023
Step  13
Liang X, Potter J, Kumar S, Zou Y, Quintanilla R, Sridharan M, Carte J, Chen W, Roark N, Ranganathan S, Ravinder N, Chesnut JD. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.
https://doi.org/10.1016/j.jbiotec.2015.04.024
Step  15
Liang X, Potter J, Kumar S, Zou Y, Quintanilla R, Sridharan M, Carte J, Chen W, Roark N, Ranganathan S, Ravinder N, Chesnut JD. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.
https://doi.org/10.1016/j.jbiotec.2015.04.024
Step  2
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED. FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
https://doi.org/10.1093/nar/gkz418
Step  3
Alcock BP, Huynh W, Chalil R, Smith KW, Raphenya AR, Wlodarski MA, Edalatmand A, Petkau A, Syed SA, Tsang KK, Baker SJC, Dave M, McCarthy MC, Mukiri KM, Nasir JA, Golbon B, Imtiaz H, Jiang X, Kaur K, Kwong M, Liang ZC, Niu KC, Shan P, Yang JYJ, Gray KL, Hoad GR, Jia B, Bhando T, Carfrae LA, Farha MA, French S, Gordzevich R, Rachwalski K, Tu MM, Bordeleau E, Dooley D, Griffiths E, Zubyk HL, Brown ED, Maguire F, Beiko RG, Hsiao WWL, Brinkman FSL, Van Domselaar G, McArthur AG. CARD 2023: expanded curation, support for machine learning, and resistome prediction at the Comprehensive Antibiotic Resistance Database.
https://doi.org/10.1093/nar/gkac920
Step  33
Gilpatrick T, Lee I, Graham JE, Raimondeau E, Bowen R, Heron A, Downs B, Sukumar S, Sedlazeck FJ, Timp W. Targeted nanopore sequencing with Cas9-guided adapter ligation.
https://doi.org/10.1038/s41587-020-0407-5
Step  33
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED. FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
https://doi.org/10.1093/nar/gkz418
Step  35
Liu Y, Tao W, Wen S, Li Z, Yang A, Deng Z, Sun Y. In Vitro CRISPR/Cas9 System for Efficient Targeted DNA Editing.
https://doi.org/10.1128/mBio.01714-15
Step  39
Gilpatrick T, Lee I, Graham JE, Raimondeau E, Bowen R, Heron A, Downs B, Sukumar S, Sedlazeck FJ, Timp W. Targeted nanopore sequencing with Cas9-guided adapter ligation.
https://doi.org/10.1038/s41587-020-0407-5
Step  55
Ruby JG, Bellare P, Derisi JL. PRICE: software for the targeted assembly of components of (Meta) genomic sequence data.
https://doi.org/10.1534/g3.113.005967
Step  56
Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2.
https://doi.org/10.1038/nmeth.1923
Step  57
Smith T, Heger A, Sudbery I. UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy.
https://doi.org/10.1101/gr.209601.116
Step  58
Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H. Twelve years of SAMtools and BCFtools.
https://doi.org/10.1093/gigascience/giab008
Step  60
Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data.
https://doi.org/10.1093/bioinformatics/btu170
Step  64
Quan J, Langelier C, Kuchta A, Batson J, Teyssier N, Lyden A, Caldera S, McGeever A, Dimitrov B, King R, Wilheim J, Murphy M, Ares LP, Travisano KA, Sit R, Amato R, Mumbengegwi DR, Smith JL, Bennett A, Gosling R, Mourani PM, Calfee CS, Neff NF, Chow ED, Kim PS, Greenhouse B, DeRisi JL, Crawford ED. FLASH: a next-generation CRISPR diagnostic for multiplexed detection of antimicrobial resistance sequences.
https://doi.org/10.1093/nar/gkz418
Step  65
Zhang Q, Ishii S. Improved simultaneous quantification of multiple waterborne pathogens and fecal indicator bacteria with the use of a sample process control.
https://doi.org/10.1016/j.watres.2018.03.023
Step  70
Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.
https://doi.org/10.1093/bib/bbs017
Step  72
Alcock BP, Huynh W, Chalil R, Smith KW, Raphenya AR, Wlodarski MA, Edalatmand A, Petkau A, Syed SA, Tsang KK, Baker SJC, Dave M, McCarthy MC, Mukiri KM, Nasir JA, Golbon B, Imtiaz H, Jiang X, Kaur K, Kwong M, Liang ZC, Niu KC, Shan P, Yang JYJ, Gray KL, Hoad GR, Jia B, Bhando T, Carfrae LA, Farha MA, French S, Gordzevich R, Rachwalski K, Tu MM, Bordeleau E, Dooley D, Griffiths E, Zubyk HL, Brown ED, Maguire F, Beiko RG, Hsiao WWL, Brinkman FSL, Van Domselaar G, McArthur AG. CARD 2023: expanded curation, support for machine learning, and resistome prediction at the Comprehensive Antibiotic Resistance Database.
https://doi.org/10.1093/nar/gkac920
Acknowledgements
We acknowledge funding from the Water Research Foundation and USEPA. We acknowledge the support from Dr. Xing Wang, Lucas D. Akin, and Abhisek Dwivedy. We acknowledge the effort in sample collection from Arthur R. Schmidt IV, Ryan McAllister, Amaja Craft, and Josie Hoppenworth. We acknowledge Dr. Rachel J. Whitaker, Dr. Jayadevi H. Chandrashekhar, and Laura C. Suttenfield in sharing Pseudomonas aeruginosa PA14. We acknowledge Dr. Jayadevi H. Chandrashekhar for her guidance in PacBio library preparation. We acknowledge Roy J. Carver Biotechnology Center for its sequencing services. We acknowledge Dr. Ashley Ceniceros, Dr. Ann Frederick, and Dr. Bruce Wellman from Carle Health for providing clinical bacteria isolates. We acknowledge Dr. Albert Cox, Essam El-Naggar, Kamlesh Patel, and Kaylyn Patterson from the Metropolitan Water Reclamation District of Greater Chicago for providing WWTP sewage samples. We acknowledge Dr. Awais Vaid and Kip Stevenson for their guidance in manhole sewage sample collection.