Sep 20, 2024
Multiplex Nested PCR for Vibrio Cholera
- Shannon Fitz1,
- Alex Shaw1,
- Dilip Abraham2,
- michael Owusu3
- 1Imperial College London;
- 2CMC Vellore;
- 3Kwame Nkrumah University of Science and Technology
- GEMS - Genomic Environmental Microbial Surveillance
Protocol Citation: Shannon Fitz, Alex Shaw, Dilip Abraham, michael Owusu 2024. Multiplex Nested PCR for Vibrio Cholera. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgqnzbkgk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 19, 2024
Last Modified: September 20, 2024
Protocol Integer ID: 108018
Keywords: PCR, Amplicon, vibrio cholera, multiplex PCR, vibrio cholera primer, multiplex nested pcr assay, nested pcr assay, toxr-for-outer, toxr-for-inner, o139-rfbrev-outer, o1-rfbrev-outer, o1-rfbrev-inner, o139-rfbfor-outer, pcr, genome, o1-rfbfor-outer, tox-rev-outer, ctxa-for, multiplex, following primer, primer
Funders Acknowledgements:
The Gates Foundation
Grant ID: INV-049092 PA4273
Abstract
Primers targeting various regions of the V. Cholera genome were obtained from the literature or designed, and optimized for a multiplex nested PCR assay.
The following primers were extracted from Hoshino et al., 1998: O1_rfbFor_Inner (modified here by Dr Alex Shaw), O1_rfbRev_Inner, O139_rfbFor_Inner, O139_rfbRev_Outer.
The following primers were obtained from Theron et al., 2000: ctxA Inner Rev, ctxA_rev.
The following primers were obtained from Nandi et al., 2000: ctxA_For, ompW_For, ompW_Rev, ompW_Inner_Rev.
The following primers were designed by Dr Alex Shaw and are unpublished:
ToxR_For_Outer, Tox_Rev_Outer, ToxR_For_Inner, O1_rfbFor_Outer, O1_rfbRev_Outer, O139_rfbFor_Outer, O139_rfbRev_Outer.
Materials
DreamTaq PCR Master Mix (2X)Thermo FisherCatalog #K1072
Approximate total cost per sample: £0.9
17 primers required (cost excluded from estimate as primers do not need to be ordered each time)
Dreamtaq cost per sample: ~£0.45 per sample, per PCR run
Extra equipment required:
Vortex, mini centrifuge, thermocycler
Protocol materials
DreamTaq PCR Master Mix (2X)Thermo FisherCatalog #K1072
Troubleshooting
Multiplex nested PCR for V.Cholera
Assemble primer pool:
| A | B | C | D | |
| Primer name | Primer | Pool C | Pool D | |
| ToxR_For_Outer | AGATGTTCGGATTAGGACAC | C | ||
| ToxR_Rev_Outer | ATGGCATCGTTAGGGTTAGCA | C | D | |
| ToxR_For_Inner | GCAGCAACGAAAGCCGAATT | D | ||
| ctxA_For | CTCAGACGGGATTTGTTAGGCACG | C | D | |
| ctxA_rev | CGATGATCTTGGAGCATTCCCAC | C | ||
| ctxA_InnerRev | GAGTATGGAATCCCACCTAAAGC | D | ||
| O1_rfbFor_Outer | CCCGACAGCCAGTGAGATAC | C | ||
| O1_rfbRev_Outer | CGTATTGCGGCGGTAAAAGG | C | ||
| O1_rfbFor_Inner | GGTTTCACTGAACAGATGGG | D | ||
| O1_rfbRev_Inner | GGTCATCTGTAAGTACAAC | D | ||
| O139 rfbFor_Outer | AACGTAGGCACTTGAGAGGC | C | ||
| O139 rfbRev_Outer | TCGCCGGTCGACTGTTTAAC | C | ||
| O139_rfbFor_Inner | AGCCTCTTTATTACGGGTGG | D | ||
| O139_rfbRev_Inner | GTCAAACCCGATCGTAAAGG | D | ||
| ompW_For | CACCAAGAAGGTGACTTTATTGTG | C | D | |
| ompW_Rev | GAACTTATAACCACCCGCG | C | ||
| ompW_Inner_Rev | GGTTTGTCGAATTAGCTTCACC | D |
Bands for the V. cholera reactions:
| A | B | C | |
| First round amplicon length (bp) | Second round amplicon length (bp) | ||
| ToxR | 875 | 723 | |
| ctxA | 444 | 223 | |
| O1_rfbF | 1085 | 196 | |
| O139_rfb | 1018 | 451 | |
| ompW | 586 | 303 |
Reconstitute primers to 100 µM using nuclease-free water (or if primer manufacturer recommends otherwise, follow their recommendations for reconstituting primers).
Create working stocks of 10 µM using nuclease-free water. Create 10 µM primer pools C and D by mixing together 10 µL of each primer marked as being part of the pool. Scale up as needed.
V. cholera first round PCR reaction
DreamTaq PCR Master Mix (2X)Thermo FisherCatalog #K1072
Prepare the following Master mix on ice in a 1.5ml Eppendorf Lobind tube per number of samples/controls + 10%:
| A | B | C | |
| 1 Reaction (µL) | Reactions | ||
| DreamTaq 2x master mix | 12.5 | µL | |
| Water | 6.5 | µL | |
| Primer pool C | 1 | ||
| Total volume | 20 |
Briefly vortex and centrifuge down the master mix and aliquot 20 µL into each PCR tube.
Add 5 µL of extracted DNA from each sample to a tube.
Briefly vortex, and centrifuge down the PCR mixes.
Amplify using the following cycling conditions:
| A | B | C | D | |
| CYCLE | STEP | TEMP (°C) | TIME | |
| 1 | Initial Denaturation | 95 | 2 minutes | |
| 35 | Denaturation | 95 | 30 seconds | |
| Annealing | 56 | 30 seconds | ||
| Extension | 72 | 3 minutes | ||
| 1 | Final Extension | 72 | 10 minutes | |
| - | Hold | 10 | - |
V. Cholera second round PCR reaction
Prepare the following Master mix on ice in a 1.5ml Eppendorf Lobind tube per number of samples/controls + 10%:
| A | B | C | |
| 1 reaction (µL) | Reactions | ||
| DreamTaq 2x master mix | 12.5 | µL | |
| Water | 6.5 | µL | |
| Primer pool D | 1 | µL | |
| Total volume | 20 |
Briefly vortex and centrifuge down the master mix and aliquot 20 µL into each PCR
tube.
Add 5 µL of first round amplicon and vortex briefly to mix. Briefly centrifuge down the PCR mixes.
Amplify using the following cycling conditions:
| A | B | C | D | |
| CYCLE | STEP | TEMP (°C) | TIME | |
| 1 | Initial Denaturation | 95 | 2 minutes | |
| 35 | Denaturation | 95 | 30 seconds | |
| Annealing | 55 | 30 seconds | ||
| Extension | 72 | 1 minute | ||
| 1 | Final Extension | 72 | 10 minutes | |
| - | Hold | 10 | - |
Check amplicons using an agarose gel or tapestation.
Protocol references
Katsuaki Hoshino, Shinji Yamasaki, Asish K. Mukhopadhyay, Soumen Chakraborty, Arnab Basu, Sujit K. Bhattacharya, G. Balakrish Nair, Toshio Shimada, Yoshifumi Takeda, Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139, FEMS Immunology & Medical Microbiology, Volume 20, Issue 3, March 1998, Pages 201–207, https://doi.org/10.1111/j.1574-695X.1998.tb01128.x
Nandi B, Nandy RK, Mukhopadhyay S, Nair GB, Shimada T, Ghose AC. Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW. J Clin Microbiol. 2000 Nov;38(11):4145-51. doi: 10.1128/JCM.38.11.4145-4151.2000. PMID: 11060082; PMCID: PMC87555.
Theron, J., Cilliers, J., Du Preez, M., Brözel, V.S. and Venter, S.N. (2000), Detection of toxigenic Vibrio cholerae from environmental water samples by an enrichment broth cultivation–pit-stop semi-nested PCR procedure. Journal of Applied Microbiology, 89: 539-546. https://doi.org/10.1046/j.1365-2672.2000.01140.x