Mar 09, 2026

Multi-pathogen detection & quantification using digital PCR V.2

  • Victor Mabasa1,
  • Natasha Singh1,
  • Emmanuel Phalane1,
  • Sipho Gwala1,
  • Mokgaetji Macheke1,
  • Nkosenhle Ndlovu1,
  • Said Rachida1,
  • Kerrigan McCarthy1,2,
  • Mukhlid Yousif1,2
  • 1National Institute for Communicable Diseases;
  • 2University of Witwatersrand
  • Wastewater Genomics Syndicate
Icon indicating open access to content
QR code linking to this content
Protocol CitationVictor Mabasa, Natasha Singh, Emmanuel Phalane, Sipho Gwala, Mokgaetji Macheke, Nkosenhle Ndlovu, Said Rachida, Kerrigan McCarthy, Mukhlid Yousif 2026. Multi-pathogen detection & quantification using digital PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.261ge87oog47/v2Version created by Victor Mabasa
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 09, 2026
Last Modified: March 09, 2026
Protocol  Integer ID: 301838
Keywords: dPCR assay, wastewater, wastewater genomics, South Africa, NICD, qiacuity digital pcr, using digital pcr, digital pcr, digital pcr this protocol, pathogen detection, pcr this protocol, qiacuity onestep advanced probe kit with hydrolysis probe, qiacuity onestep advanced probe kit, dpcr, pcr, quantifying rna, dna target, reactions on qiagen, qiagen, hydrolysis probe, singleplex, rna, probe, quantification assay
Funders Acknowledgements:
Gates Foundation
Disclaimer
Parts of this protocol are derived from the QIAcuity OneStep Advanced Probe Kit User Manual.
Abstract
This protocol is optimised for quantifying RNA and DNA targets using the QIAcuity OneStep Advanced Probe Kit with hydrolysis probes in singleplex or multiplex (up to two targets) reactions on QIAGEN’s QIAcuity digital PCR (dPCR) instruments. It also includes instructions for preparing in-house 20× primer–probe assays. This version includes our in-house designed hepatitis B detection and quantification assay.
Materials
1.5 mL Eppendorf tubes
Standard 96-well plate
Microseal Adhesive Seal
QIAcuity 8.5K, 96-well Nanoplate
Pipettes of different sizes
Multichannel pipettes
QIAcuity OneStep Advanced Probe Kit
Before start
  • Refer to the QIAcuity User Manual and QIAcuity User Manual Extension for guidance on assay design and experimental setup for the QIAcuity platform.
  • The QIAcuity OneStep Advanced Probe Kit has been specially formulated with a hot-start RT enzyme, allowing users to assemble reactions at room temperature
  • The Enhancer GC is recommended for use with all Applied Biosystems TaqMan assays, amplicons >150 bp in length, GC-rich amplicons, and RNA targets containing challenging secondary structures.
Assay set-up in a clean-room
Place the following on ice to thaw:
  • 100x OneStep Advanced Reverse Transcription Mix,
  • 4x QIAcuity OneStep Advanced Probe Master Mix
  • Template RNA
  • Primer-probe Mix
  • Enhancer GC
  • RNase-Free Water
Vigorously mix the individual solutions and centrifuge the tubes briefly to settle the liquids
Using the calculations in Table 1, prepare a master mix in a clean 1.5 mL Eppendorf tube. Remember to add 10% of each component to account for pipetting errors.
Table 1: Assay composition
Componentx1 samplex? samplesFinal concentration
4x OneStep Advanced Probe Master Mix3 µL µL1x
100x OneStep Advanced RT Mix0.12 µL µL1x
20x primer-probe mix 10.6 µL µL0.4 µM forward primer 0.4 µM reverse primer 0.2 µM probe
20x primer-probe mix 2* (for multiplex)0.6 µLµL0.4 µM forward primer 0.4 µM reverse primer 0.2 probe
Enhancer GC1 µLµL-
Total reaction volume5.32 µLµL-
? = number of samples + controls + 10%, * = substitute with RNase-Free water for singleplex assay

Vortex the reaction mix thoroughly and briefly centrifuge. Dispense 5.32 μL of the reaction mix into each well of a standard 96-well PCR pre-plate (according to your experiment layout).
Note
The pre-plate may be assembled at room temperature.

Add nucleic acids in PCR-room
Add 8 µL template RNA to wells containing the reaction mix. Thoroughly mix the template RNA with the reaction mix by pipetting up and down.
Seal the pre-plate with a microseal adhesive suitable for standard 96-well plates and briefly centrifuge (1000 rpm for 30 seconds) to collect any droplets.
Transfer 13.32 μL from each well of the pre-plate to a 96-well QIAcuity Nanoplate, taking care to avoid introducing bubbles.
Note
Always place the Nanoplate on a Nanoplate Tray when handling to protect the sensitive imaging surface at the bottom. Do not place the Nanoplate on ice at any time—work at room temperature.

Seal the Nanoplate with the seal provided in the kit, load it into the QIAcuity instrument, and initiate the one-step RT-dPCR cycling program below.
Note
This cycling program works for all* different primer-probe combinations, despite their different melting temperatures. This is possible because of

QIAcuity RT-dPCR cycling program
Table 2: QIAcuity RT-dPCR cycling program

StepTimeTemperature
Reverse Transcription40 min50°C
RT Enzyme Inactivation2 min95°C
2-step cycling (45 cycles)--
Denaturation5 sec95°C
Combined annealing & Extension1 min60°C

Preparing in-house 20x primer-probe assay
If you choose not to purchase QIAcuity pathogen detection assays from QIAGEN, you may source your own primers and probes and prepare them as 100 μM stock solutions.
Thaw your primers and probe on ice and prepare a 20x assay as indicated in Table 3 below.
Table 3: Preparing 20x primer-probe assays

ComponentFinal Conc. in 20x assayVolume to add
Forward primer (100 μM)8 μM8 μL
Reverse primer (100 μM)8 μM8 μL
Probe (100 μM)4 μM4 μL
Nuclease-free water-80 μL
Total-100 μL

Our working assays
All primers and probes are sourced from IDT through Whitehead Scientific. The reporters, internal quenchers, and 3′-end quenchers used in the assays below may be proprietary to IDT. When designing assays, carefully consider the compatibility of the selected reporters and quenchers, and exercise particular caution when planning multiplex assays to avoid cross-reactivity between chemistries.

Influenza A assay

Primer/probeSequence (5'-3')
InfA For1CAAGACCAATCYTGTCACCTCTGAC
InfA Rev1GCATTYTGGACAAAVCGTCTACG
InfA Probe/56-FAM/TGCAGTCCT/ZEN/CGCTCACTGGGCACG/3IABkFQ/
Research Use Only CDC Influenza SARS-CoV-2 (Flu SC2) Multiplex Assay Primers and Probes

Influenza B assay

Primer/probeSequence (5'-3')
InfB ForTCCTCAAYTCACTCTTCGAGCG
InfB RevCGGTGCTCTTGACCAAATTGG
InfB Probe/5YakYel/CCAATTCGA/ZEN/GCAGCTGAAACTGCGGTG/3IABkFQ/
Research Use Only CDC Influenza SARS-CoV-2 (Flu SC2) Multiplex Assay Primers and Probes

Pan-measles assay

Primer/probeSequence (5'-3')
MVN1139FTGGCATCTGAACTCGGTATCAC
MVN1213RTGTCCTCAGTAGTATGCATTGCAA
MVNP1163Probe-2/56-TAMN/CCGAGGATGCAAGGCTTGTTTCAGA/3BHQ_1/
Hummel, K.B., Lowe, L., Bellini, W.J. and Rota, P.A., 2006. Development of quantitative gene-specific real-time RT-PCR assays for the detection of measles virus in clinical specimens. Journal of virological methods132(1-2), pp.166-173.

Measles vaccine strain assay

Primer/probeSequence (5'-3')
VMA168FGAGATTGGGGGGCAAGGAAGAT
VMA242RGCATCACTTGCTCTGCTGGGCC
VMA190PFAM-AGGAGGGTC/BMN-Q535/AAACAGAGTCGA-MGB
Ndlovu, N., Mabasa, V., Sankar, C., Msomi, N., Phalane, E., Singh, N., Gwala, S., Els, F., Macheke, M., Maposa, S. and Yousif, M., 2024. Wastewater testing during the South African 2022-2023 measles outbreak demonstrates the potential of environmental surveillance to support measles elimination. medRxiv, pp.2024-09.

Rubella assay

Primer/probeSequence (5'-3')
RV98 GGCAGTTGGGTAAGAGACCA
RV251r CGTGGAGTGCTGGGTGAT
RV159rp /5Cy5/ACATCGCGCACTTCCCACG/3IAbRQSp/
World Health Organization, 2007. Manual for the laboratory diagnosis of measles and rubella virus infection. In Manual for the laboratory diagnosis of measles and rubella virus infection.

Hepatitis A assay

Primer/probeSequence (5'-3')
HAV-68-F TCACCGCCGTTTGCCTAG
HAV-240-R GGAGAGCCCTGGAAGAAAG
HAV-150-Probe /56-FAM/TTAATTCCT/ZEN/GCAGGTTCAGG/3IABkFQ/
Costafreda, M.I., Bosch, A. and Pintó, R.M., 2006. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Applied and environmental microbiology72(6), pp.3846-3855.

Hepatitis E assay

Primer/probeSequence (5'-3')
JVHEVF GGTGGTTTCTGGGGTGAC
JVHEVR AGGGGTTGGTTGGATGA A
JVHEVPmod-2/5TexRd-XN/TGATTCTCAGCCCTTCGC/3IAbRQSp/
Jothikumar, N., Cromeans, T.L., Robertson, B.H., Meng, X.J. and Hill, V.R., 2006. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. Journal of virological methods131(1), pp.65-71.

Mpox generic assay

Primer/probeSequence (5'-3')
N3R-FTCCAATTATGACCTTTGATGGAA
N3R-RTGTTTAATTGTAGGACGGTTGT
N3R-P/56-FAM/TCCATCTAT/ZEN/CTCGTTCATGGTCGGT/3IABkFQ/
B18R-FTGGTTGCCGGATCTACGTATT
B18R-RACGTTCTTAGTCGGTGCATT
B18R-P/5Cy5/CTAGTTGCTAGATCTCTCGCTATCATAG/3BHQ-3/
Fan, Z., Xie, Y., Huang, B., Zhao, F., Hu, Y., Huang, Y., Mei, S., Wei, L., Wang, L., Wang, L. and Gao, Z., 2024. Development of a multiplex real-time PCR assay for the simultaneous detection of mpox virus and orthopoxvirus infections. Journal of Virological Methods328, p.114957.

Mycobacterium complex assay (IS6110)

Primer/probeSequence (5'-3')
TB_ForTCCACGGCCTGGGCTACCA
TB_RevCATCGCGCACGCATCGGG
TB_Probe/56-ROXN/CACTCCGCCGATCGTTTTTCC/3IABkFQ/

Mycobacterium tuberculosis assay (Glycosyltransferase)

Primer/probeSequence (5'-3')
ForwardTCCACGGCCTGGGCTACCA
ReverseCATCGCGCACGCATCGGG
Probe/56-ROXN/CACTCCGCCGATCGTTTTTCC/3IABkFQ/
Park, J., Kwak, N., Chae, J.C., Yoon, E.J. and Jeong, S.H., 2023. A two-step real-time PCR method To identify Mycobacterium tuberculosis infections and six dominant nontuberculous mycobacterial infections from clinical specimens. Microbiology spectrum11(4), pp.e01606-23.

Hepatitis B assay

Primer/probeSequence (5'-3')
HBV3-26FCGTGTTACAGGCGGKGTKTTTCTT
HBV60-83P/5Cy5/AGACTCGTG/TAO/GTGGACTTCTCTCAA/3IAbRQSp/
HBV111-39RTGGAGRTTDGGGACTGCGAATTTWGGCCA
Designed by Wastewater Genomics Syndicate at NICD, SA

Assays ordered ready-made from Qiagen

Assay nameGeneGlobe IDReporter
SARS-CoV-2 (N1) DMA00710ROX
Vibrio CholeraeDMA00340TAMRA
Dengue virus (pan)DMA00788FAM
Hepatitis BDMA00808FAM


Protocol references
This protocol is derived from the QIAcuity OneStep Advanced Probe Kit User Manual.

Fan, Z., Xie, Y., Huang, B., Zhao, F., Hu, Y., Huang, Y., Mei, S., Wei, L., Wang, L., Wang, L. and Gao, Z., 2024. Development of a multiplex real-time PCR assay for the simultaneous detection of mpox virus and orthopoxvirus infections. Journal of Virological Methods328, p.114957.

Jothikumar, N., Cromeans, T.L., Robertson, B.H., Meng, X.J. and Hill, V.R., 2006. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. Journal of virological methods131(1), pp.65-71.

Costafreda, M.I., Bosch, A. and Pintó, R.M., 2006. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Applied and environmental microbiology72(6), pp.3846-3855.

Hummel, K.B., Lowe, L., Bellini, W.J. and Rota, P.A., 2006. Development of quantitative gene-specific real-time RT-PCR assays for the detection of measles virus in clinical specimens. Journal of virological methods132(1-2), pp.166-173.

World Health Organization, 2007. Manual for the laboratory diagnosis of measles and rubella virus infection. In Manual for the laboratory diagnosis of measles and rubella virus infection.

Research Use Only CDC Influenza SARS-CoV-2 (Flu SC2) Multiplex Assay Primers and Probes.

Ndlovu, N., Mabasa, V., Sankar, C., Msomi, N., Phalane, E., Singh, N., Gwala, S., Els, F., Macheke, M., Maposa, S. and Yousif, M., 2024. Wastewater testing during the South African 2022-2023 measles outbreak demonstrates the potential of environmental surveillance to support measles elimination. medRxiv, pp.2024-09.

Park, J., Kwak, N., Chae, J.C., Yoon, E.J. and Jeong, S.H., 2023. A two-step real-time PCR method To identify Mycobacterium tuberculosis infections and six dominant nontuberculous mycobacterial infections from clinical specimens. Microbiology spectrum11(4), pp.e01606-23.